Shemeska
Adventurer
Reposting this by request. It's a few years old, but the original location it was uploaded to on Planewalker died at some point.
“The more we do to you, the less you believe we're doing it.” – Dr. Joseph Mengele
“How does it feel?”
That was the first question that I asked him.
The man shuddered and jerked where he stood at the edge of the bluff, looking out over the burning landscape below. The city, his city, was in ruin, the vineyards and fields but black squares of ash and smoldering verdant flesh.
Cellulose, orange flame, 930 degrees, acrid caramelization of the components of the cellulose is swiftly overrun by their dissociation into organic radicals and finally naught but charcoal, wind from the west fanning the flames higher to a yellow orange glow to finish the process as the sparks turn to flame, turn to fire, turn to smoke and billow up into the mortal’s face
He squinted and stumbled and I asked him again, though barely a second had passed while my observations had run their circuit of eyes to brain to pen to paper.
“How does it feel?”
The crackle of flame, the scream of pain, and the rage of fiends through the city faded away from the jellied meat of his skull as he turned and looked up at me.
Mortal. Human. Yellow/brown skin, melanin consistent with his sphere’s inclination against its parent star. Heart rate 115 beats per minute, blood pressure rising, 140 / 90, pumping hard and fast through capillary beds in his face as their associate arterioles constrict and he pales considerably.
I stood before him, backlit by the fires in the distance to the south and the collapsing gate back to Oinos. He was shorter than I, five feet ten inches compared to thirteen and seven, and so I loomed over him, throwing him into shadow. Though not perhaps obvious to those unfamiliar with him, given his emotional state, he was intelligent, highly so, and he was learned in the lore of fiends, the summoning of demons, the contractual vulgarities and vagaries of diabolism, and he’d gleaned no small bit of knowledge from a ragged copy of the Book of Keeping. He was guilty, responsible for the fires that raged across field and foundation and in Tanar’ric hearts all about.
C9H13NO3 floods his bloodstream, adrenaline, he is horrified, afraid. His eyes bulge, his jaw slackens, his legs tremble, and in his brain I see the patterns of his thoughts, read his every notion as he is forming them and even before his cranial organ of flesh and possibility has given him an awareness of them in the first place I am recording them.
‘Who are you? What are you? Powers above save me!’ His mind rattles the thoughts in duplicate, triplicate, resonating from nerve to nerve, synapse to synapse firing in conjunction like battalions of archers defending their dendritic castles against any higher thought as –fear- permeates, saturates, overwhelms.
I gazed down at the human and waited, my actions hinged upon his, watching, waiting, listening, and recording. He was a theurge of no specific god, but rather he was devoted to the abstracts of Xaos/Chaos/aXoS/xsOS and all other permutations of the theme. Combined with his knowledge of Wild Magic as an arcane discipline, he was a potent worker of the Art.
But all things in perspective I suppose…
I made no preemptory motions, I simply stood there, waiting for him to act and realize both that I was not there to rip his soul from its fleshy shell (though I could have) but also to realize the utter futility of his situation. The sooner he was convinced of either, the sooner that I would be able to question him.
But ah! Violence… the refuge of the desperate, the refuge of those without options, and of those without the sense for anything grander and subtler. I watched while a pattern of arcane words flickered across the mortal’s brain.
Abjuration, evocation, transmutation. He ponders all types of responses, though in truth he has no vague clue of what I am, nor what my intentions are, only seeing the towering blasphemy before him and assuming the worst given his current circumstances. ‘Shall I dismiss it? Banish it? Send it hurtling back to whatever layer of the Abyss spawned it?’ His brain churns and roils, conflicted as to its most appropriate response. ‘Flame? Ice? Disintegration? Or barring them all, I can always flee.’ The choice forms in his matrix of ganglia, blood, and neurotransmitters, action potentials blurring across their playground of warm, wet wires: ‘banishment!’ is their frenzied cry.
I did nothing of course. The spell was hurled at me, quickly, expertly, and with more than a bit of skill, but alas for his hopes, it did absolutely nothing. It never had a chance frankly, as it didn’t penetrate any of my natural resistance to magic, and had it done so, it would have been snuffed by the other defenses in place about my being, to say nothing of a counterspell on my part had I felt it necessary. And had it, I’d have simply returned a moment later, none the worse off.
But regardless of the hypothetical, his spell was snuffed like a rearing wave breaking against a firm seawall. Squelched, it was gone with no trace of its passing.
He was not expecting me to still be present.
His voice falters, he falls to his knees, and within the epithelium lining the lachrymal ducts within the meat of his face the cells respond to a cascade of information, messengers, chemicals, hormones, like biological prayers from protein to nucleic acid. At their core the helical strands separate and belch forth a sequence of information that as with all I dutifully record. The biological rutting of mortal matter within his body is a chorus of screams and whimpers to me, as I see it all in every detail in every second within his presence, but this pattern is soothing in its implications. Its begins with its initial pattern of agagccttcgtttgccaagtcgcctccaga… onwards to the end before it is refined, reworked, and translated into the first budding peptides of lactoferrin that ultimately well up, collect, and bead like translucent pearls of misery to dribble down his face as he begins to cry.
I continued to stare at him of course, and I continued to collect my records, my data, my observations as he waited for the end to arrive. He expected me to kill him.
“You have yet to answer my question.” I stated softly. “I did not come here to butcher you and feed upon your soul like the Tanar’ri and other fiends that you and yours saw fit to summon here, much to your lament.”
His sobbing paused and he glanced up at me, suddenly curious in some small manner despite his crushing regret that perfumed the air. His fear was lifting, if only momentarily.
“Then why are you here?” He asked. “And what are you? Who are you?”
“Because I have come to watch.” I answered him succinctly. “I have come to speak with you. After all, you are responsible for this.”
He gazed around once more and gave a sigh of complete and utter resignation.
Good. Interesting. Though not verbal he acknowledges his guilt at least to himself.
“What I am is of little importance, but I will humor you, my fellow scholar.” I continued. “You may call me Sarkithel fek Parthis, The Chronicler, Gloom Father, Baernaloth…”
His brain ignites once again with a spreading synaptic brushfire, patterns of memories accessed and released as he tries to recall even a mention of myself or of my kind. He finds nothing of the sort amid his recollections, though the term of ‘Gloom Father’ strikes some vague, dim detail lurking at the back of his brain. Tempting as it is to snuff that spark before it catches, I allow it to smolder as his heart rate slows, pressure dropping, exocrine glands receiving less and less stimulation, and he grows calm. Good.
“I’ve never heard of you before.” He said, worried that failure on his part to know of me might incite rage.
Nothing of the sort. Nothing at all of the sort. I sit, legs crossed, book open and perched upon my ankles, pen in hand, calm, exuding cold serenity. Complacence, stoicism, peace, dispassion, tranquility, sang-froid.
“Are you a yugoloth?”
“In a manner of speaking.” I shrugged. “Perhaps. They might claim so.”
“The Book of Keeping does not mention you…”
“And why would it?” I ask rhetorically.
Does a historian, a scholar, a sage, a scientist, an engineer, or a clinician insert themselves into their work? Does a researcher insert himself into his experiments? No, of course not.
He is confused. It plays across his face like a ripple across a pond. Worry momentarily breaks the surface and he registers a wash of doubt, a notion of intent on my part that is malign. But no, there is no intent here, not in the active sense of the word. Passivity. Permissiveness. Only in this light is there intent.
He had no answer, and in the momentary lull I turned the page of my book.
Of course, the movement of pen on page and the rote flip of paper is not entirely necessary. Every moment that he stares up at me stupidly, a spare drop of spittle hung on a stray whisker at the corner of his mouth, seventy two thousand bacteria swirling suspended in its depths, filipodia twitching, slowly rotating clockwise… every single one of these spare moments I am writing and recording within these pages. This book itself is a construct, a physical metaphysical metaphor, only a representation, and itself devoid of actual material worth.
“But as I said before,” I began. “There is the matter of, well… just look around you…”
I spread my hands and glanced out at the carnage that surrounded us both. He did not deign to look, but my point was well taken in the glazed, despondent hollows of his eyes.
“Yes…” He admitted, slouching. “We… I didn’t mean it to happen. It was never meant to escalate this way.”
“So tell me your story.” I said, gesturing with the ink-laden tip of my pen. “Describe to me the events leading up to this moment of flame and sorrow. Nothing like this simply happens, there are always circumstances, situations, complexities, and a cause to the effects. Someone is always culpable, regardless of the presence of pride, guilt, or any sense of responsibility.”
He gazed up at me.
“Tell me your story. Justify or condemn your own actions. Spin me a tale to explain our surroundings. Detail it as you will, in your own way, in your own time, because I wish to listen, I wish to record, I wish to learn.”
I wish to savor. I wish to indulge. I wish to paw and sniff in pleasure in the afterglow of the perversion of good intentions. Whisper in my ear of what you intended while we sit in the funeral pyres’ glow. I take succor in the path you took just as much as I smile at the ending results. Humor me wretch with your misery.
“Why?” He asked, wary yet in his despondence.
“A loaded word, regardless of language.” I replied, stroking a finger across my chin. “Why do I wish to learn the sordid details of your world’s destruction? Why do I sit here in front of you patiently rather than exanguinating your corpse and feasting on your wriggling petitioner? Or perhaps why have the flames from below not yet extinguished the oxygen in the air and left one or both of us gasping and flopping like stranded whales?”
My blunt reply is spoken with virtually no negative emotions, only a vague and rhetorical curiosity, and he is taken aback by it. Rather than pacify him, it only sparks a nagging fear in his brain. The image of myself suddenly leaping forward and ripping him to pieces takes form in his mind's eye, and then is gone as soon as the notion comes to him, heralded and trumpeted by the spastic firing of the semi-peripheral nerves in his gut. ‘Why am I still alive?’ His brain whimpers. Why am I still alive indeed! Simple questions have simple answers, but you've not tumbled to them yet. Letting you do so, and watching your realizations form and solidify is something of a delicacy to me. But ah, no, anguish takes his hand, gouges his eyes and leaves them bloody on the road next to its own as they blindly proceed down a wrong path entirely. Such is what happens, and such I shall watch.
"I'm dead already." He said. "Aren't I?"
Not at all, not at all, not at all. Death will skew your perspective; death will make you worthless to my observations here. You are not dead my mortal, not dead at all. And yet the cock has not crowed before the dawn my suffering martyr. Killing you now would be a single moment of pain and then an eternity of it, but there is a difference. Anguish and loss is so much sweeter, so much more poignant when it is mortal, when it sits wedded to a beating heart and a mind consumed with its own temporality. When there is still the conceivable option of something better, when there is still the rarest notion of hope in the mind of a living subject, it is a much sweeter vintage to our lips. I will not end this and drink vinegar before I must. I have no interest in taking your cup of suffering from you, I wish you to sup from it for me to drink from your lips, from the source before the source runs dry and bitter. It is so much better this way you realize. Live as long as you will.
"You are still alive." I said to him. "Your heart is beating and you still draw breath. Your mind is still full of rational thoughts and not delusions. You are very much still alive. I only have interest in you this way."
"Am I in hell?"
"From a loaded word to a loaded question." I replied. "You’re not in hell, not in the sense that you mean. But of course you mortals have done your best to bring a hell, one of them, two of them, to your doorstep with a candle burning in the window, an open door yawning, and a promise of a filling meal."
Do not quicken the arrival of your screaming descent, that would provide me with little. The end matters yes, but the interim just the same, or even more all things considered. Breath, exhale, let the ashen air kiss the layers of collagen, laminin, fibronectin, adherin... the tuning forks of gristle you play for my benefit with each word passing from your mouth. I've seen the candle burning in the window, the wax has yet the snuff the flame, and you have time still to whisper in my ear a promise of a meal in and of itself.
He paused, uncertain at my answer. So I answered him more bluntly.
"You are not in hell."
Not mine. Not yet.
"But you have done your best to unleash the hells, the lower planes, on your world. That is what I am interested in, and it does me no good to do you harm before listening and recording your story."
He looked at me with weary eyes, finally grasping the truth that he was indeed still alive, that I was not going to harm him. I simply wished to question and then to listen.
“I observe and record.” I repeated. “I do not interact, I do not influence.”
"I half expect you to be a figment of my guilt here to torment me.” He said. “For all I know, I'm dying, caught in the last moments of life and hallucinating. Why should I answer you? It only makes me remember what I've caused. Why are you interested in this, in me?"
“Again with the heavy handed questioning.” I said, gaining information even as he interrogated me. “That is what I do, this is what I am. If you do not fully understand this now, I will explain in due time, in my own way.”
He stared at me, skeptical and also fearful as well. He had thrown his last spells at me moments before. He’d pooled his remaining powers, cannibalized his mind’s arcane cache in that failed attempt to send me back whence I’d come. He had nothing left.
“Please.” I asked. “Humor me. I will not harm you. I am simply interested in learning what led to all of this. When we are done, I will step back and let you do whatever you wish to do. I will not interfere.”
The mortal finally seemed to relax, and oddly enough he actually seemed to trust me on some level. But I suspect that he was simply too tired, too filled with despair to actually bother to resist. Apathy filled him and acceptance was the result.
“We did not start this.” He stated flatly before giving a bit of a shrug. “The war itself had been going on periodically for generations before I was even born. The start of it all, that broader tempest of words and blades is lost to history, and frankly irrelevant now.”
Five hundred and thirty years to be exact, all beginning with a bit of vague and disputed language in the final will and testament of Emperor Durengal the Bold. Three years and several deaths later, his nation split into two bitterly divided kingdoms of Jurin and Tevoria, each ruled by one of his sons, their families, and their own vassal houses. In something I must of course smile over, the original disputed language was due to scribal error, not the actual terms dictated by their liege lord himself. They rage, they die, and all is pointless poetry of suffering.
“What ultimately led to this all…” He motioned around, his voice choking with displaced guilt. “They initiated it all! The Jurinites! They were the first to breach the planes and summon hellspawn.”
He means Baatezu, though he does not verbalize this response. It plays across his thoughts like the marching of ordered, organized troops conquering the territory across his visual cortex and midbrain. He hates these puppets of his enemies, unaware that his enemies were consumed in rather short order by the law-spawned fiends. No need to tell him of course, it will disrupt his recollections and sully his response. Allow him to operate under the presumption that his actions were required, if ultimately wrong, and perhaps tell him later when appropriate.
“Please continue.” I said, my words hitting his ears and hurling those marching thought patterns into disarray like his subsequent actions had attempted to do to the baatezu.
“But it was our response,” He admitted. “It was our response to their actions that brought us to this end. It was what we did that caused everything to spiral out of control. Faced with seemingly unending waves of devils, we realized that we could not kill them or banish them all. That was much too simple, and the situation didn’t allow for it. It would have been like fighting the tide from coming in by digging a trench in the sand as the waves lapped around you.”
Visions of barbazu fill his mind, all aligned in their ranks, their pikes glistening in the rising sun, faceless little ants marching in formation. He saw them. He was there with his people when they marched against them in battle that first time. Erinyes take to the air in his memories, gelugons and cornugons and even a pit fiend. My mind recognizes each and every one of them for whom the mortal’s memory paints an accurate picture. Norazhok of the Twelve Tongues, a pit fiend under the authority of Phanior, Lord of the First Command.
Norazhok…Norazhok…Indeed I know this one well. Pages turn and working in reverse I watch him melt in the fires of Phlegethos and resume a prior form of a cornugon, before which he was an amnizu, before that a spinagon, and before that a lemure formed from a larvae from the Waste sold to the Baatezu by the Hags. The irony is of course, that in life, that squealing petitioner wriggling in the dust upon our birthright flesh had been a soldier in the military of Jurin. I appreciate this most salient point, even while I hold its presumption of karmic justice in contempt.
I smiled ever so briefly the moment that he looked away into the distance.
“We realized that they had done one of two things.” He explained. “Either they had summoned and bound, or otherwise reached some contractual agreement with a noble Baatezu, maybe even one of the Nine, or they had opened a permanent portal to the Hells and managed to regulate the influx of troops in accordance with their will.”
Baatezu and a firm –lack- of control is the extreme irony in this case. They never had control, not once. And the longer I sit here listening to you, the longer I listen to -them- and filter through their memories of this as well. You are not the sole object of importance here. Rather you simply sit at the confluence of events and in a geographic locale that is convenient to my eavesdropping. You are a crumb of blood soaked cake at the edge of the first dish of many on this table, itself but the first course in a meal yet to evolve and transpire.
“After consulting one another, the other mages and I and the generals of Tevoria, it was decided that we would summon other devils. With luck, we would manage to find out the specifics of what the mages of Jurin had done.”
I nodded and let him continue.
"Much to our chagrin, none of the devils we called and bound answered us." He said. "They simply refused to speak. Eventually though, we managed to elicit one thing from them. It was a hamatula who finally broke their code of silence, and it was she who informed us -of- their code of silence, sneering and gloating with her eyes if not so much in her words. She simply said that our enemies, she did not specify beyond that, had purchased an agreement with the hells so that they would go unopposed and the devils would not be forced by conflicting contracts fight amongst themselves."
I nodded and turned a page, reading the exact words of the Hamatula in question. She is currently up for promotion, assuming she survives the holocaust working its way across the surface of this sphere.
Our silence has been purchased by virtue of binding contract between Archmage Marena of Jurin and her majesty Boremgotha the Singed of the Ministry of Mortal Relations, in association with the Court of Mephistopheles. Ancillary contracts have been drawn for the use of yugoloth mercenaries, overseen and approved by Fadreth the Golden Tongued of the Ministry of Immortal Affairs in Grenpoli, penned in duplicate by Zaereneth Ibn Portent and deposited in the archives of the first and second parties.
And this of course, the 'loth, was the obvious route to my being aware of the situation and storm clouds brewing over the home sphere of Jurin and Tevoria. But the obvious reasons are usually the least valid, especially where We are concerned, especially where I am concerned. I'd been waiting for this for a very long time, and my interest hinged on multiple levels of the conflict, like a layered sweet, a confectionary of a dozen different honeyed delights. The ‘loth simply told me that the time had arrived for this current tumbler to fall in a very complex lock, a chain and sequence of events that we’d been waiting for, watching develop according to plan.
Unaware of my contemplations though, the mortal continued his recollection, and regardless of my train of thought, his words had been and were continuing to be put to paper, put to memory, savored and their use contemplated.
"Whatever price the bastards had paid, they wished to make certain that we would be damned one way, and not the other. We could not purchase our own ransom from the fiends, not those fiends, not ever. I wish I could have known what they paid for such loyalty, because we found none at the opposite end of the spectrum."
Tanar’ri are not precisely known for their loyalty. To say nothing of the middle of the continuum…present company included.
"Did you seek out their ideological opposites, or did they come to you, offering you salvation while sniffing at the scent of your souls?" I asked, already knowing full well the answer.
"We hesitated at first, and debated for a week what our course of action would be. Some of us suggested from the outset to seek aid in the demons of the Abyss, others suggested we abase ourselves to the heavens, some abandoned us and preemptively fled, while yet others including myself thought it best to continue our attempts to communicate with the Baatorians."
He lies of course, and he knows this. He considered running along with his cowardly brethren, but he stopped at the last moment; the shame of this dashes through his mind like a man set alight within yards of a body of water. His revisionist recollection and retelling is commendable. I let him continue as he wishes. Far be it from me to prevent a lie from being told, after all, I seek the perversion of truth, not the disruption of fact. The difference is in the intent and in the point of view. Truths change, facts do not. I am here seeking his -truth- not his facts, those are already known to me a hundred times over. His words, his feelings, his remorse, his emotions, his attempted warping of fact becomes a -truth- to him, and it and how he molds it are the interesting things at hand. Descent. Spiral, spiral, spiral, pitch and turn, ever downwards little man.
"So what did you do, finding the Baatezu unwilling to budge in their prior agreements?"
"I was in the middle of an attempt to summon an Amnizu." He answered. "It was my hope that an agent of Levistus, one steeped in the draining touch of the Styx might be able to answer questions whose answer was largely absent from the minds of others. I never finished the summons though, I didn't have to, because it was preempted."
"Explain."
The scent of my children approaches now, though in this particular event their inclusion is key but minor, an undertone in this song of desolation. They have done well, little puppets, all with a -truth- of their own.
"I'd just finished the binding circle, and its translucent membrane had begun to refract and reflect the light of a dozen tallow candles in the chamber. I was alone as I did this, I'd sealed the door, and my fellows were off on their own, doing only the Hells know what."
The hells had nothing to do with this mortal, though I do detect a tinge of bitter irony inflected in your voice as you use that particular expression. Nothing but Greed was involved here. No grand manipulation, not on this level of action, this level of input, variables, and living reagents.
"I was ready to invoke the true name of the Amnizu, one Izacar the Bitter, in the direct service of Levistus. I'd hoped to avoid the ministries altogether, sidestepping the Dark Eight entirely."
The mortal began to recite the events and I settled myself, relaxed and listened while he prattled on, slipping into his mind in the process to gather the details from his perspective.
The light flickered, like a wind had blown across the wicks, and I looked up into the fading luminescence of a gate. It was subtle and quick, like a great blue and winking eye, there across the circle from me.
And I was not alone. A single figure stood just within the bounds of the circle. Luck might have smiled upon me then, but the circle was specific, far too specific to bind anything but an Amnizu, it might have even failed to hold other devils of that type except for Izacar himself.
A single figure swathed in fine robes, but what hangs in my mind still was a play of opposites that it presented before he even approached and I saw his face. A bestial snarl and the soft swish of silk against silk, the odor of brimstone and the scent of perfume, the wet sound of lips parting in a smile and then a tongue tasting the air like a serpent preparing the strike.
The figure strode into the light, moving forwards with an elegant, arrogant swagger before rapping its knuckles against the inside membrane of the binding circle’s wards, knocking upon it like an arcane door, sending ripples across its surface.
“Greetings and well met.” The fiend said, stepping into the light of the candles.
He was dressed in black robes trimmed with blue silk, a wizard with the head of a maned wolf, clawed hands clasped together at his waist. A well-dressed fiend is still a fiend though, even if he was smiling rather than screaming for blood, even if his claws were polished and engraved, and even if his long mane of ruddy-gray fur was brushed and pulled back, braided together into an elaborate knot with golden wire at his shoulders.
The mortal is confusing two separate meetings here with Y’leris, a brief, first meeting alone and a later meeting with many more wizards, and a few more ‘loths present.
“Who are you?” I demanded, standing to my feet and pointing a wand at the fiend’s chest.
“Y’leris.” He answered. “Though I suppose if you wish to have my full title, that would be Y’leris Ap Gehinnom, 34th scribe of the Abscess of the Hollow Heart. No need to be so formal though, and besides, I’m here with your best interests in mind.”
“And I could banish you in a heartbeat.” I replied, not returning his smile.
“Tsk tsk tsk…” He chided whimsically. “That would be rash I think, given the predicament you find yourselves in. And one that…”
The fiend trailed off to look down at the circle, moving one of his feet and reading the runes carved into the layer of wax that composed the outermost layer of the wards.
“And one that Izacar the Bitter probably couldn’t help you with anyways, assuming he wasn’t bound by overriding agreements to not speak with you.”
I narrowed my eyes and stared at him. He was right, and he knew it as he grinned.
“You’re in a bit of an untenable position,” He said. “But I can help you. My clients that I represent can help you greatly. Shall we talk?”
“What exactly are you?”
“I am Yugoloth, and we, my kind, are called arcanaloth.”
I knew what that implied, but I’d had no firsthand experience with his caste, so I let him explain himself.
"We are middlemen, of a sort." The arcanaloth said. "We are involved in the conflict between Tanar'ri and Baatezu, yes, but not in so straightforward a way, and not for either side in particular. Self interest, enlightened or not, is what defines us in many ways."
He paused, clasped his hands and stepped forwards into our midst, robes swishing and claws clicking staccato on the stone floor.
"We, myself, my clients, we wish to offer you our services."
"Who do you serve?"
"Interesting question that is..." He said, holding up a clawed index finger and smirking. "In general, or specifically in this case?"
"Yes."
"In general, myself, as that's all that matters really."
And from his perspective he is certainly right. That is his -truth-, that his own self-importance is the overriding factor within the hostile reality he is part of. Everything exists to be taken, used, given pain for his enjoyment simply because he wishes to do so and he can. Truth is that, and on some level it is also a fact, but only by ignorance of the larger whole of universal Evil. He is not ignorant of it though, he embraces it in many ways to give you my -truth-, a self-defining self-delusion, a liar’s lie to himself, a child of the Waste to the end. We are pieces, self-absorbed extensions of the godhead.
"And now, in this case, in specific?"
He gave a languid smile and paused for dramatic effect, overly dramatic effect.
"I am Yugoloth, but in this case I serve as agent and painted little temple whore to Hethradia, Prince of Demons. My singular/dualistic master would increase his great prestige and personal power by blunting the Baatezu here on this world.”
And give itself purpose, give itself focus, give itself clarity amidst the madness and struggle against his self, his other self, a literal house divided. A different creature entirely, but the struggle outwards placates and forestalls the struggle inwards, a similar thing to the little 'loth's focus through dissolution, importance through absence, but Demogorgon has a different Truth
"What is the price?"
"And therein lies my importance here. Let us talk and discuss your situation and salvation, shall we?"
Of course we paid too much, far too much, but as he’d said, our position was rather untenable. We were lost without some form of outside help, and that help was being offered up to us on a silver platter, dressed to our liking, if only we would sign on the proffered page of screaming, bleeding parchment.
Deeds, abstinence from the calling and binding of Baatezu for a period of decades, the banning of certain faiths, the oppression of others, the souls of half of those in our forces who fell during the coming slaughter. The terms were dictated in part, and half of them were offered up by our own people who were giving up things that meant nothing to them compared to their own survival, and their own continuance of power and prosperity.
The hope of salvation had turned us to greed, and greed had turned us to damning ourselves. I should have banished the fiend in the first place, but he would have just gone to another one of my peers, and they would have committed my sin themselves, taking his hand and welcoming him in to seduce us with words, to deliver us into the hands of his masters.
And in the end, we offered them more than they had been asking.
And of course the jackal-headed whelps looked at one another, licking their chops hungrily, and agreed
“My place in this is done.” Y’leris said. “Arsephlena the Divided will be my replacement in this matter as of three hours from this point. She speaks for the Divided Prince, and will command his forces here. Our forces, yugoloths in service to the demiurge of the Brine Flats, they will answer to an Ultroloth in the service of the Overlord of Carceri, but he will neither speak with, nor consult with you.”
I didn’t speak to the fiend as he incanted the words of his exit from our midst, but he had one last parting word to me. And I think he was more right than not.
“I suspect that we’ll be seeing one another again at some point though. Direct or indirect, savor what you’ve wrought.”
Indirect, as Y’leris has already moved on to other masters, having sold his services to Orcus within an hour of penning his deal on behalf of Demogorgon. He now serves under the nominal authority of Glyphimhor in the fortress of Tcian-Sumere, expanding his studies of necromantic lore in the depths of the Negative Energy plane, and also working to understand the lingering traces and taint of Tenebrous during that being’s occupation of the fortress. This one we will see again in due time, with his allegiances switching with the direction of the wind
And now I sit forward to listen more keenly to the mortal, as he begins to talk of the Tanar’ri, and the coming Blood War spillover
“And what happened next?” I asked him, holding up the tip of my pen to catch the light.
Pearly, opalescent in the light filtering through the smoke. There is no physical interaction though, as the ink does not exist in a material sense. It is a conception of ink, molded by thoughts and perceptions. It has the refractive index of a tear at the moment, a mortal tear mixed with a cold sweat, the proteins, exuded oils, and necrotic bacterial refuse that accompanies such. It reflects this mortal’s mood at his signatory role in the slaughter
“They came that evening on the rim of a storm from the east.” He answered. “It might have been coincidence, but more likely they had some of their kind there already to conjure the weather, or it might have been our world itself weeping for us with the rain, chiding us angrily with the crackle of thunder.
Things are bleeding together though, and events went quickly. But I remember the marilith, their general, the one the wolf-headed ‘loth had spoken of. She was hideous, a once beautiful woman with six arms and the lower body of a serpent, but something had happened to her in the past. Her serpent tail had been cut in half, split into two like a forked tongue writhing below her waist, and above that she was bald and covered in scars or acid burns.”
Nine hundred and twelve years prior on the slopes of Mungoth. It was a formative event for her
“Did they obey you at first?” I asked as I penned down the history of Arsephlena the Divided, adding this latest chapter into her career. “Did they obey the contract at all? Did they ravage your people from the start, or did they make a play at obeisance?”
“They spoke with us as little as possible actually, and when they did, their contempt was obvious. They had only nominal concern for our people, and in retrospect, it was only their generals, Arsephlena and several dozen others of her kind, along with the vrocks that eventually darkened the skies that even seemed to be implicitly aware that they had penned an agreement with us in the first place. The rest of their hordes that arrived by the hour, but they were simply cowed into submission and forced to fight, or held back from their own savage glee to slaughter the devils they could almost smell.”
“Did you not expect that? That is how the Tanar’ri operate.”
The mortal shrugged and refused to answer, a sting to his pride perhaps, a prick against his competency. In the reflected light of the flames, that bead of ink at the tip of my quill welled heavy and red.
“Describe to me the progress of the conflict. Did you go with the fiends yourself? Did you send your own people with them? Or…?”
“We didn’t trust their loyalty, nor should we have.” He replied with a scoff. “We sent our own forces into battle with them, but we held them back as observers just as much as actual combatants. We kept half of them within sight of our capital, ready to defend the city if the devils and their allies broke through, or the demons turned on us.”
“Your contingencies were wise.”
“Was that a compliment?” His asked as his face wrinkled. He wasn’t sure if it was a cruel barb, or an honest admission.
It is a question, a double-edged sword, honeyed venom. I elicit a response, even if I fail to garner an answer. I deduce what I deduce. I gather answers one way or another, you should grow wise to this soon, and the realization will give me more. The method of questioning is just as important as the questions themselves.
“Was it? Did your actions end up being wise in the light of what happened? Describe what you learned from your men at the front.” I answered him with a request.
“Our enemies were not present. It was only the Baatezu and a sprinkling of their hired yugoloths. At this stage now, I assume that they were already conquered or butchered by the devils that they had bargained with, probably some contractual loophole that they’d failed to notice.”
“I suppose that I can take some satisfaction there however.” He continued, waving a hand dismissively. “They had lost before we had lifted a finger, not that it helped us in any way of course.”
“But back to the conflict itself…” I prompted.
“Everything spiraled out of control the moment the two fiendish armies met. Things fell apart. Normal armies would have clashed and then retreated, paused to reconsider their position. They would have regrouped, resupplied, rested and made plans for the next stage of conflict.”
“But not the fiends.” I said, answering what he’d have left unsaid.
“No, they did no such thing. They slaughtered one another without pause, without rest, without retreat. They avoided us at first, but then as their numbers began to dip, they began to summon more of their kind.”
“Oh?”
“Normal summons at first, but then their more powerful members began to open gates. Those gates, they were what changed everything. We hadn’t addressed such things in any of our dealings. Those who came through the gates, they weren’t under the control of The Divided, they weren’t bound by agreement or word, they were simply there on their own, and they made no distinctions between devil or mortal or even their own kind.”
“Caught between blood-dimmed tide and reef, what did you do?”
He did not answer me, he just stared at the ground and my pen ran clear and warm, a saline fountain to match that welling in his eyes.
Shame. Abject shame. He ran. I watch it in his mind, hearing those same cries of misery, death rattles all around him, blood pumping hot in veins and in vain spilling on soil all around. He ran. He fled the scene of battle. He left his people to their own devices.
“They continued to fight. They tried to escape, to flee the field and regroup but…”
“But?...”
“I am here and there aren’t.” He replied. “That should answer your question.”
I smiled at him, and for a second time now he was taken back. It was an awkward expression, but it was as genuine as I was capable of. He’d answered my questions, but of course he wasn’t finished yet.
“You returned here.” I stated. “Had you already realized that everything had devolved beyond a point of no return? Had you come to understand what would follow?”
“Legions of devils under no command but their own, our own armies of demons now outnumbered by others of their kind who were under none of our artificial strictures… yes, I knew what would happen.”
“And it was worse by that point though, wasn’t it?”
“The mercenaries in both camps abandoned the battle when our pretensions of control evaporated.” He said bitterly. “I can see that smug smile on the face of the fiend who’d penned our agreements in the first place. I understood what he meant by savoring what I’d wrought.”
“The city was under siege already when you returned, wasn’t it?”
“Under siege? The city was burning. The fiends never needed to travel overland, they had no need to breach the walls or tear apart the gates. They simply vanished and went where they wished. By the time that we realized our control was crumbling on the battlefield, our world was already being torn apart under their hands.”
“Tanar’ri? Baatezu? Yugoloth?”
“Tanar’ri and Yugoloth.” He replied. “I suspect the Baatezu had enslaved and plundered the Jurin kingdoms already, and the yugoloths were only picking through the remains there once they had the chance like flocks of cackling vultures.”
“But they had a greater prize with your people, one largely untouched by exterior plunder.”
Plump, succulent, virginal, ripe on the vine and ready to pluck, fatted calves ready for the altar and they the high priests. But you are reserved for my cup and mine alone; the dregs are what they will claim.
“I came back to…”
He abruptly paused as I began to cough, first leaning forwards out of some woefully ill-founded concern, and then jerking back several feet out of self-preservation and fear. I was doubled over for several moments, spewing lines of yellow sputum onto the ground, with drops of blood sizzling in the ashen loam, while dots of color and distortion swam across my eyes.
But I am used to this. This is not some cross I bear, it is simply what I am and have always been. I find it amusing to read the words of those ascetics who believe that pain carried without complaint ceases to be a burden, that they purify themselves by depriving themselves of comfort. Fools. It purifies, but not in the way that they believe. Not at all. Not in the least. It fuels the fire, it fans the flames, it purifies the will and sharpens the desire. Beat me! Shame me! Drive in the nails! Flog me on my way to Golgotha to hang in perpetuity! Misery is what we are, and we are not deprived of it ourselves, not in the slightest!
"You... what is wrong with you?" He asked, his pity sickening to each and every one of my senses.
I did not answer him. I could not answer him. Not with words, spitting forth the flesh of my lungs as I was, peppering the soil, myself, and my book with that burden, that birthmark, that stigmata of our calling and our birth.
He could only watch as the convulsions grew more and more severe.
He stuttered as I shivered and salted the earth with my own vomit. The fit itself was short, only three minutes and seventeen seconds, and near the end I was crying, rigid and bracing myself against the ground. He couldn't bring himself to ask me the question burning in his head, but regardless of my ecstasy/agony, as my trembling receded and I was able to incline my face and look into his eyes, my own wide and trembling, smiling with blood and bile trailing down my chin, I gave him his answer.
“Yes. It hurts. More than you can possibly imagine...”
But you have sipped from this cup, eternally at the brim, eternally filled from within and without. You know it, you have tasted it, and here we are to taste of you. Belbau ussa zhaunil bauth dos’xukuth pholor nindol? как это чувствует? Wie fühlt es? Answer me in your pitiful way. Speak. Weep. Tell me what I want to hear. Bleed. Speak.
I was so near to him, smiling, trembling in my own chronic pain, looking into his eyes. He was frozen, speechless from fright. I did not touch him, I said nothing to him, but he looked back into my eyes. It was my expression through the pain… that it what terrified him, my embrace of what he felt in only the smallest drop.
My coughing, or rather his backwards movement in response, it stirs the air like the wings of a butterfly, the smallest, most tiny of things turning the direction of the molecules of air, then a breeze, and then the wind, shifting the currents of air and carrying the scent of a living mortal down the burning wind, down towards the west and the waiting fiends that will catch it and follow it. My little monarch, my little X, my beautiful Y, hark to the rumbling, gathering storm.
My trembling smile abrogated, and returned to a cold, curious stare. He was quiet and still, and for several minutes not a sound passed between us, only the crackle of the flames and distant screams, and other, more subtle noises that he could not yet hear. I eventually broke the silence with another question though.
“And what did you find there in your burning city? What were your intents there? Tell me.”
He is frightened still. He is now unsure that I will let him live. Answer me. Answer my questions. Answer the question. I hear them approaching now even if you cannot. Como se sente? πώς αισθάνεται? Renthisj Ar-munthrek irthir? Tell me! Answer me! I beg of you!
“I came back for my family.” He said with a tremble to his lip. “I came to find them. I came to save them. I wanted to secret them away to safety, and if I could not spare them what was coming, I would have killed them, given them a quick and painless death before taking my own life…”
“But you are still here…”
“They were ripping apart the city. Don’t you understand?! They were taking the towers and citadels themselves. One by one they’d snatched them away to other planes, or simply looted them and gutted them with flame after taking what they could.”
“And your tower? Your family? Your wife? Your children? Marena? Lucian? What of them?”
It slips his mind that I name his children.
“I saw it as they ripped it free from its foundations.” He said, pale and broken. “It hung there for a few seconds before it vanished. I don’t know where it went, what plane it was carried to. I only know that I saw the face of one of my children looking out of the uppermost window when it did. He saw me, he was looking at me, and I saw the face of the grinning fiend behind him whose fingers on his chin were showing him where to look.”
Burying his face in his hands he wept while below us in the ruins, a quarter mile distant the canoloths sniffed the wind. They turned their heads, directing their minders in our direction, up towards were we sat atop the bluff, smelling fear on the wind, smelling blood and suffering upon their tongues, lashing and tasting. Of course, I did nothing as they approached.
But you see, you do not matter in the least. You are not important. Do you think that others will cry at your passing? Your world is dead. It in and of itself is not important. I am not here simply because of you; you are only a tiny part of this, and not even the most important part, just a formative one. You are like a butterfly you see. You brushed your wings against this world and events have now passed beyond you in our little game in this cold and fickle multiverse. You have played your part and now the curtains have fallen. You have done what you were to do and now I have come calling to see, to feel, to watch, to listen, to taste, to pluck.
During our time together, sitting and chatting, there had been other fiends that had passed us by. None of them had seen us; carefully tailored circumstance had ensured that. The smoke had obscured us and masked our scent, the flames and wind had hidden our banter and our forms, but none of it had been a magical ruse on my part. I’d simply set the conditions and allowed things to proceed.
My mortal was aware that he had been safe while we had spoken, but he had assumed that it was because of action of my part. He’d though himself safe in my presence, both from any malign action on my part, and from the actions of other fiends. Vrocks, succubi, and even a Nalfeshnee had flown by overheard, and groups of rutterkin and mezzoloths had marched by without coming within a dozen yards.
Surely some revelation is at hand.
He had heard the snarl and hiss of a molydeus, the roar of a goristro, and the barking laughs of arcanaloths, and all the while he’d thought himself safe. How unfortunate for him when the first blind maw of a canoloth topped the crest of the hill and looked directly at him. It never noticed me of course as its drool pooled on the earth and its barbed tongue curled outwards, tasting and seeking.
“You seem relaxed.” I said. “You were suicidal before, but don’t you intend to protect yourself? You have no spells remaining but still, I would have expected more resistance, not willing martyrdom.”
As expected, he looked to the canoloth and then back to me in dawning horror. “But they are yours!”
“In a manner of speaking.” I replied as another four of the ‘loths topped the crown of the hill, surrounding us. “To be honest, they are more yours than mine. You brought them here. They are drawn to you.”
“But you said that you only wished to talk, to learn of what I did!” He was on his feet in an instant, stumbling and confused. “You said that you would not harm me! You said…”
“Have I harmed you?”
“No but…”
It was not yet dawn, but for the third time during our meeting, I smiled at him.
The snarling grew louder. The pack approached closer with the snapping of jaws, the wet snarl of a piscaloth, and the telepathic banter of the nycaloths giving them their orders. The mortal was trapped. There was nowhere to go.
“Thank you.” I said as I stood to my feet and stepped back, giving him more room to run, more room to struggle.
He realized his fate fully at that moment when I held my book to the side and waved at him, a pantomime of his child watching him before vanishing at the mercy of the fiends who had taken his tower and his family with it. He realized it then, just before the canoloths leapt atop him, ripping him to pieces, tearing him apart.
And of course I watched. Passionately. Apathetically. Rapt in my detachment. Why? Because I could, because I can, because we do, because I enjoy it. It is what I am. Why sit by and watch? Why take no part? Cold, distant, clinical?
It allows me to ask my question.
How does it feel?
Tell me your pain; describe to me your misery. Whet my tongue and quicken my pen across the page, a litany of what it means to be one of you. Curious. Abhorrent. We were there to watch you crawl from the muck, the slime, the dust, the primordial ooze, life from unlife, but you are guilty of our creation nonetheless. Suffer for me and I will watch, I will record, I will allow.
Suffer for me.
How does it feel?
Sarkithel fek Parthis – The Chronicler
The following was penned anonymously and delivered into the hands of the Fraternity of Order in Mechanus by a member in good standing of the Guardian sect, bearing a personal seal of Duchess Callisto of Elysium. The information is presented without comment below, though without attribution and references, even with the high level authority its accuracy has been vouched for by, the Fraternity cannot declare it affirmed as accurate:
Some have suggested that Sarkithel fek Parthis is somehow different than his fellow kindred among the Demented. Certainly the Chronicler is more subdued than many of his kin, and among those who have encountered him, while they feel horrified and sickened by his presence, they do not report him to be overtly violent. In fact, the Chronicler seems to prefer to avoid involving himself in the affairs of the planes, at least directly and overtly. Sarkithel does not poison a well or set fire to a keep, he is the one who watches the victims writhe in agony from taint or flame, doing nothing to harm them himself but taking puissant, vicarious pleasure in the propagation of the acts themselves.
Sarkithel fek Parthis is malign apathy.
He is detached cruelty.
He is distant curiosity detached from ethics.
And what are you to claim to know me? I know you. I know you well. Shall I spill your secrets as well?
The Chronicler is just as his name implies. He records the process of Evil, the progress of his kindred’s schemes, the spread of the Baerns’ moral contagion across the planes, acting as the secretary and historian of the Hegemony of Evil. He fills his role, and despite the seductive wish to label him as different from and untouched by the madness of his brother/sisters, he is likewise affected and afflicted.
Did you enjoy the look on that Asura’s face when you drowned him in the shallows of Oceanus? Did your divine patron’s desires absolve you of guilt? Or do you still worry?
There are multiple interpretations of neutral evil, just as each alignment can be manifest in different pure forms. Examples of this include the Parai and the Modrons, the Baatezu and the Kytons, and most poignantly the Rilmani and the Kamarel. In the latter case the Rilmani exist as a balance of all alignments in perfect equilibrium while their largely extinct antitheses were a rejection of them.
And there are multiple paths to universal Good, but none of you can agree on what that universal Good actually is. You are a tinder pile waiting for a spark.
It has been speculated that the Demented are an aberration among their kind, a sickness that presents itself as the norm, but in the absence of active involvement on the planes by their ancient kin, it is difficult to say that they are not correct in their claims of orthodoxy by default. The Demented exist as an embrace of the conflicting and seemingly mutually exclusive extremes of universal evil, something that they, or perhaps their now vanished fellows, sought very early on to exclude from their children the Yugoloths.
Adults withhold things from their children. Sometimes they are given to them at a later age of maturity, and sometimes they are allowed to learn and discover them on their own.
The Demented are ravaged by a sickness of being and mind, oft described as a twisted, mind-altering malady which manifests in their outlook and quixotic obsessions. Other Baernaloths are said to be simply withdrawn, apathetic, no longer filled with enough care to take an active role upon the planes, no longer possessed of the motivation to commit evil rather than simply wallow in isolation amid their own melancholic despair: oddly like the Chronicler himself.
Do not be deceived by this surface parallel.
No, the deception comes later, and frequently, often by us on ourselves. The greatest deceptions are self-inflicted.
The Chronicler may possess a veneer of Baernaloth orthodoxy, but he is every bit as active as his brethren among the 13. The hallmark of the Demented is that, in their sickness, they seek to manipulate their surroundings in meticulous, Byzantine fashion. The Chronicler, despite surface appearances perhaps to the otherwise, does this as well; he simply does so in a different and unique manner. While his brother/sisters directly insert their influence into events, or orchestrate subtle string pulling across millennia to do the same, Sarkithel is there to watch these events and processes, actively aiding and abetting his fellows in their madness by his –inaction- and his detached observations. Events occur, conditions are set, and observations are made amid the fallout.
Are you any different? You seek to manipulate others. Do you mollify your guilt by the notion that your actions are allowed, justified by the fact that you do them for the betterment of others.
Inwards however, within the cesspool of his mind, the Chronicler is just as warped as his fellows. In some instances he actively suppress his own desires to more directly steer the course of what he views as his experiments should he reach the conclusion that a given situation has not developed as expected, and there is no data of worth to be gained from continued observation. But his suppression is not uniform, and in some of these instances, he apparently has no compunctions against what amounts to sterilizing the laboratory and aborting a failed experiment. Sarkithel’s dispassion only goes so far, and inwardly he feeds upon the fallout, the active conclusion, of his inaction.
Shall I recite the death count performed in the name of Good? Or Law? Or Chaos? Balance? Am I so much more than them, because I enjoy my methods and their results?
In line with his apathy and pretensions of orthodox modality, the Chronicler is deceptively mundane in appearance and form as well. Among the Demented, he is aberrant in his lack of aberration, perverse in his normality, a lie wrapped in the cloth of the prosaic.
And what of you oh anonymous author? Does Elysium make you safe? Or does it suffocate your desires?
Fallen far from the tree of extremes represented by the Inquisitor, the Shackler, the Dire Shepherd, and above all the Ineffable, Sarkithel is disturbingly normal for his ilk, more in line with the forms of the Lie Weaver and the Blind Clockmaker. The Chronicler has the prototypical form of a Baernaloth, though perhaps one that is decidedly more spindly and frail in appearance than the norm (if there is indeed a norm), displaying no striking deviations, mutations, or flaws. Furthermore, even the sickness that he carries like a cross, or more aptly a willing stigmata, is largely understated: a form of pneumonia or pneumatic plague that is relatively quiescent except for rare periods of wet and bloody coughing.
Is there something normal for us? Does the waste engender normality in Hordelings? In the desires of Ultroloths?
In fact, the only thing of particular note about the Chronicler is that he is always observed with his book. His own particular hallmark, he has never, not once, been observed without it, though the exact size and style seems to vary, potentially according to the viewer. Some have described it as a slim artists’ or authors sketchbook or notebook, others have seen it manifest as a thick wizard’s tome, some have described it as a long codex of folded scrolls, while still others have described more fantastic sorts of ‘books’ such as tablets of wet clay, wooden scratchboards, and sheets of singed linen.
In any event however, there is always a volume in which the Chronicler takes notes, be it an actual physical book, or a variable manifestation of an appropriate cultural archetype. The Chronicler does appear to take notes in the book, meticulous and voluminous notes, but by his own admission this physical act itself is only a fraction of the material recorded across perhaps hundreds of pages each and every moment that he tasks his mind to it. He is nothing if not obsessive in his attention to detail.
And you have found little, despite your own attempts to plumb my mind. Do you worry that you spread lies in the name of truth?
But ultimately now, this leaves us with a description of the Chronicler himself, a log of his features, his motivations, an intimate record of his dispassion. To do him justice, to complete this record of him, this chronicle of him, there should rightfully be history to accompany and place this raw record into additional context.
And what good will this do? What do you feel you will accomplish?
Unfortunately here we have more speculation and suggestion than actual confirmed lore. The Chronicler is recorded in various places to have appeared at select moments leading up to, but more often during or just after great events and major turning points in history across the planes. An apocryphal githyanki text titled ‘To Know the Liberator’ claims that a being known as The Contemptuous Watcher was there on Avernus, waiting for Gith, standing at the border of Tiamat’s divine domain. The text claims that the two of them spoke at length for some time, and that afterwards Gith vanished into the Dragon Queen’s domain, never to return.
And would it be so disturbing if Gith had not been martyred, or betrayed, but had been pulled screaming into the pit. Not a messiah but a blood offering by her beloved betrayers? You are born not of triumph and self-sacrifice but of shame, cowardice, avarice... tell me...How does it feel?
The text also goes on to say that this same being appeared in Tu’narath after Ephelemon’s declaration to Vlaakith regarding the fate of Gith. The contents of their discussion are not recorded, but the text implies that Vlaakith betrayed her racial savior for power. It should be noted however that only one copy of this particular text is known to exist in full, apparently in the possession of an Alhoon and former hierophant of Maanzicorian. In light of this, the text may be more Illithid propaganda than anything else, so this particular piece of apocrypha may itself be apocryphal for our current subject.
But things are rarely so straightforward where the Gloom Fathers are concerned. Regardless of the status of the rumored full text of 'To Know the Liberator', there are stories that swirl around the imperfect copies, at least five of which are known to circulate. Those who read these flawed and incomplete versions report a distinct feeling of being watched as they do so, a cold, disturbing presence staring back at them from the pages and ink of the book itself. A githyanki warlock by the name of Caerek Grev’ir who confiscated one such copy reported that despite five separate attempts to do so, he was unable to burn the text.
And I think that you’ll find it amusing, the way in which he ultimately died. But did the flames die on him the same way that they did on that Asura?
He also reported that while he never himself opened it to learn what heretical tales it told, he was glad, relieved even when he threw the tattered collection of thin leather pages into a color pool to the Abyss. From the moment the book was in his possession, he reported a presence, something staring at him, watching him, observing him. He never once felt alone till he divested himself of the book.
How does it feel?
There are other stories as well, tales of other such books. They are books that hold some provocative twist upon accepted history, books that advance topics and notions that invoke some strong reaction in their readers. And these books are said to watch back, almost like living things, or windows for their creator to peer through, observing how the words of the books affect their readers, regardless of the truth or fiction they claim to tell. Reaction is reaction, and there is even a tale of one such book, a book of Truth, said to speak only absolute and damning fact, that was last held by an Ultroloth. The ‘loth, a prince of his kind, supposedly opened the book and beheld what abhorrent truth it spoke to him. What it said was never recorded, but he never spoke again before binding the tome in iron chains and his own flayed skin before burying it in the Waste and drowning himself in the Styx.
It seems that he didn’t appreciate my Truth, regardless of the facts. Another point in the progression of the experiment.
Personally present or not, the Chronicler seems to seed the field of his experiments and watch the conditions that result. The results are just as important as the transition that leads to whatever end occurs. He seeks 'truths' just as he seeks out facts, gorging himself upon the misery that results from the difference.
In the end what is the difference? What is your –truth-?
Sarkithel is also mentioned, this time by title, in a text purporting to detail the history of the Gautiere of Carceri’s layer of Minethys. In this instance, the Chronicler is reported as having watched the sealing of the prison-tomb of the Tiere’s divine patron, and spoken with several of the betrayed god’s former high priests after the fact. Perhaps this gives him too much credit though. Certainly the Baernaloth is not omnipresent.
I am willing to give you a list. A complete list. Come visit me and let me watch your reaction as you read. That would be my only price. My offer stands.
But when the Chronicler is not actively observing what he might determine to be key moments in the history of the planes, he is most often noted as dwelling on a semi-permanent basis on the 4th mount of Gehenna, somewhere in the ruins of an ancient city in a site known only as the Vale of Frozen Ashes. The site comprises a several mile wide swath of rubble, scarcely more than hollow shells of buildings, lines of foundations, and the broken remnants of a once massive cathedral at the city center. Otherwise the city is desolate and unoccupied, save for the Baernaloth, and save for the statues…
My eternal companions. They are always with me there. We are waiting, watching. You will see it too. We are waiting for the signs to manifest themselves.
The city is ‘populated’ by thousands of statues, tens of thousands of statues formed from compacted, frozen ashes like the entire population of the realm was in some ancient past incinerated and then flash frozen in an instant of hell. The statues, or quite possibly the remains, are primarily of fiends, mostly yugoloths, though there is also a sizable fraction of celestials of all types present as well.
Like those who were turned to pillars of salt for daring to look upon the works of a wrathful, jealous god
The statues whisper.
Would you care to know what they say? You will hear it in time. It is a warning. They have seen what will come. The clock is winding down.
The city itself is constantly awash with a subtle current of whispering wind and skittering, drifting ashes that to keen ears seem to be the weeping, terrified whispers of the dead who remain locked in petrified misery within the Vale. And it is these whispers that the Chronicler is largely obsessed with, taking note of them, recording them, and even speaking to the tormented dead around him in his madness. The content of the whispers is unknown, but they are always apprehensive if not downright terrified of something. Though it is only speculation, the Baern may use them like a bizarre oracle of sorts, or they may simply be, in their own way, slowly telling him of some ancient event that yet holds his interest.
They speak and I listen. But I already know everything of which they warn, everything they fear, because I have seen it. But foreknowledge does not make their worry any less a pleasure on my part.
The statues might also be speaking of an event that somehow has yet to occur but already has, given some bizarre statements by Sarkithel when he has been encountered by travelers in Gehenna during periods when he was lucid enough and willing to converse with them. “Waiting for the signs to manifest themselves” was his explanation for his occupation there in the city that was “rebuilding itself to happen again. Crawling towards an undesired apotheosis.”
Undesired? That all depends of course on who is speaking and who is listening. Visit me. Leave your gilded prison.
So keen to observe the city and record the dim whispers of its inhabitants, the Chronicler may never actually leave it. It seems very likely that Sarkithel is present in multiple places across the multiverse at any given moment, projecting his consciousness across the planes in some form of avatar in order to record the process of certain events that are either considered key, or simply interesting to him or his kin. Such meetings are inevitably harmful, though in comparison, face-to-face meetings with him in Gehenna are typically neutral, assuming that those seeking to converse with him are protected from the unique environment. Such meetings are not advisable however, and I would warn against them. Misery draws him, and misery flourishes in his wake.
Afraid of what I might tell you? Do come visit. You might even learn a bit about me. I’ll be waiting for you my child. Come visit and maybe you’ll finally feel alone, finally be alone. Reading from that book… come and we shall talk of what you read.
“The more we do to you, the less you believe we're doing it.” – Dr. Joseph Mengele
***
“How does it feel?”
That was the first question that I asked him.
The man shuddered and jerked where he stood at the edge of the bluff, looking out over the burning landscape below. The city, his city, was in ruin, the vineyards and fields but black squares of ash and smoldering verdant flesh.
Cellulose, orange flame, 930 degrees, acrid caramelization of the components of the cellulose is swiftly overrun by their dissociation into organic radicals and finally naught but charcoal, wind from the west fanning the flames higher to a yellow orange glow to finish the process as the sparks turn to flame, turn to fire, turn to smoke and billow up into the mortal’s face
He squinted and stumbled and I asked him again, though barely a second had passed while my observations had run their circuit of eyes to brain to pen to paper.
“How does it feel?”
The crackle of flame, the scream of pain, and the rage of fiends through the city faded away from the jellied meat of his skull as he turned and looked up at me.
Mortal. Human. Yellow/brown skin, melanin consistent with his sphere’s inclination against its parent star. Heart rate 115 beats per minute, blood pressure rising, 140 / 90, pumping hard and fast through capillary beds in his face as their associate arterioles constrict and he pales considerably.
I stood before him, backlit by the fires in the distance to the south and the collapsing gate back to Oinos. He was shorter than I, five feet ten inches compared to thirteen and seven, and so I loomed over him, throwing him into shadow. Though not perhaps obvious to those unfamiliar with him, given his emotional state, he was intelligent, highly so, and he was learned in the lore of fiends, the summoning of demons, the contractual vulgarities and vagaries of diabolism, and he’d gleaned no small bit of knowledge from a ragged copy of the Book of Keeping. He was guilty, responsible for the fires that raged across field and foundation and in Tanar’ric hearts all about.
C9H13NO3 floods his bloodstream, adrenaline, he is horrified, afraid. His eyes bulge, his jaw slackens, his legs tremble, and in his brain I see the patterns of his thoughts, read his every notion as he is forming them and even before his cranial organ of flesh and possibility has given him an awareness of them in the first place I am recording them.
‘Who are you? What are you? Powers above save me!’ His mind rattles the thoughts in duplicate, triplicate, resonating from nerve to nerve, synapse to synapse firing in conjunction like battalions of archers defending their dendritic castles against any higher thought as –fear- permeates, saturates, overwhelms.
I gazed down at the human and waited, my actions hinged upon his, watching, waiting, listening, and recording. He was a theurge of no specific god, but rather he was devoted to the abstracts of Xaos/Chaos/aXoS/xsOS and all other permutations of the theme. Combined with his knowledge of Wild Magic as an arcane discipline, he was a potent worker of the Art.
But all things in perspective I suppose…
I made no preemptory motions, I simply stood there, waiting for him to act and realize both that I was not there to rip his soul from its fleshy shell (though I could have) but also to realize the utter futility of his situation. The sooner he was convinced of either, the sooner that I would be able to question him.
But ah! Violence… the refuge of the desperate, the refuge of those without options, and of those without the sense for anything grander and subtler. I watched while a pattern of arcane words flickered across the mortal’s brain.
Abjuration, evocation, transmutation. He ponders all types of responses, though in truth he has no vague clue of what I am, nor what my intentions are, only seeing the towering blasphemy before him and assuming the worst given his current circumstances. ‘Shall I dismiss it? Banish it? Send it hurtling back to whatever layer of the Abyss spawned it?’ His brain churns and roils, conflicted as to its most appropriate response. ‘Flame? Ice? Disintegration? Or barring them all, I can always flee.’ The choice forms in his matrix of ganglia, blood, and neurotransmitters, action potentials blurring across their playground of warm, wet wires: ‘banishment!’ is their frenzied cry.
I did nothing of course. The spell was hurled at me, quickly, expertly, and with more than a bit of skill, but alas for his hopes, it did absolutely nothing. It never had a chance frankly, as it didn’t penetrate any of my natural resistance to magic, and had it done so, it would have been snuffed by the other defenses in place about my being, to say nothing of a counterspell on my part had I felt it necessary. And had it, I’d have simply returned a moment later, none the worse off.
But regardless of the hypothetical, his spell was snuffed like a rearing wave breaking against a firm seawall. Squelched, it was gone with no trace of its passing.
He was not expecting me to still be present.
His voice falters, he falls to his knees, and within the epithelium lining the lachrymal ducts within the meat of his face the cells respond to a cascade of information, messengers, chemicals, hormones, like biological prayers from protein to nucleic acid. At their core the helical strands separate and belch forth a sequence of information that as with all I dutifully record. The biological rutting of mortal matter within his body is a chorus of screams and whimpers to me, as I see it all in every detail in every second within his presence, but this pattern is soothing in its implications. Its begins with its initial pattern of agagccttcgtttgccaagtcgcctccaga… onwards to the end before it is refined, reworked, and translated into the first budding peptides of lactoferrin that ultimately well up, collect, and bead like translucent pearls of misery to dribble down his face as he begins to cry.
I continued to stare at him of course, and I continued to collect my records, my data, my observations as he waited for the end to arrive. He expected me to kill him.
“You have yet to answer my question.” I stated softly. “I did not come here to butcher you and feed upon your soul like the Tanar’ri and other fiends that you and yours saw fit to summon here, much to your lament.”
His sobbing paused and he glanced up at me, suddenly curious in some small manner despite his crushing regret that perfumed the air. His fear was lifting, if only momentarily.
“Then why are you here?” He asked. “And what are you? Who are you?”
“Because I have come to watch.” I answered him succinctly. “I have come to speak with you. After all, you are responsible for this.”
He gazed around once more and gave a sigh of complete and utter resignation.
Good. Interesting. Though not verbal he acknowledges his guilt at least to himself.
“What I am is of little importance, but I will humor you, my fellow scholar.” I continued. “You may call me Sarkithel fek Parthis, The Chronicler, Gloom Father, Baernaloth…”
His brain ignites once again with a spreading synaptic brushfire, patterns of memories accessed and released as he tries to recall even a mention of myself or of my kind. He finds nothing of the sort amid his recollections, though the term of ‘Gloom Father’ strikes some vague, dim detail lurking at the back of his brain. Tempting as it is to snuff that spark before it catches, I allow it to smolder as his heart rate slows, pressure dropping, exocrine glands receiving less and less stimulation, and he grows calm. Good.
“I’ve never heard of you before.” He said, worried that failure on his part to know of me might incite rage.
Nothing of the sort. Nothing at all of the sort. I sit, legs crossed, book open and perched upon my ankles, pen in hand, calm, exuding cold serenity. Complacence, stoicism, peace, dispassion, tranquility, sang-froid.
“Are you a yugoloth?”
“In a manner of speaking.” I shrugged. “Perhaps. They might claim so.”
“The Book of Keeping does not mention you…”
“And why would it?” I ask rhetorically.
Does a historian, a scholar, a sage, a scientist, an engineer, or a clinician insert themselves into their work? Does a researcher insert himself into his experiments? No, of course not.
He is confused. It plays across his face like a ripple across a pond. Worry momentarily breaks the surface and he registers a wash of doubt, a notion of intent on my part that is malign. But no, there is no intent here, not in the active sense of the word. Passivity. Permissiveness. Only in this light is there intent.
He had no answer, and in the momentary lull I turned the page of my book.
Of course, the movement of pen on page and the rote flip of paper is not entirely necessary. Every moment that he stares up at me stupidly, a spare drop of spittle hung on a stray whisker at the corner of his mouth, seventy two thousand bacteria swirling suspended in its depths, filipodia twitching, slowly rotating clockwise… every single one of these spare moments I am writing and recording within these pages. This book itself is a construct, a physical metaphysical metaphor, only a representation, and itself devoid of actual material worth.
“But as I said before,” I began. “There is the matter of, well… just look around you…”
I spread my hands and glanced out at the carnage that surrounded us both. He did not deign to look, but my point was well taken in the glazed, despondent hollows of his eyes.
“Yes…” He admitted, slouching. “We… I didn’t mean it to happen. It was never meant to escalate this way.”
“So tell me your story.” I said, gesturing with the ink-laden tip of my pen. “Describe to me the events leading up to this moment of flame and sorrow. Nothing like this simply happens, there are always circumstances, situations, complexities, and a cause to the effects. Someone is always culpable, regardless of the presence of pride, guilt, or any sense of responsibility.”
He gazed up at me.
“Tell me your story. Justify or condemn your own actions. Spin me a tale to explain our surroundings. Detail it as you will, in your own way, in your own time, because I wish to listen, I wish to record, I wish to learn.”
I wish to savor. I wish to indulge. I wish to paw and sniff in pleasure in the afterglow of the perversion of good intentions. Whisper in my ear of what you intended while we sit in the funeral pyres’ glow. I take succor in the path you took just as much as I smile at the ending results. Humor me wretch with your misery.
“Why?” He asked, wary yet in his despondence.
“A loaded word, regardless of language.” I replied, stroking a finger across my chin. “Why do I wish to learn the sordid details of your world’s destruction? Why do I sit here in front of you patiently rather than exanguinating your corpse and feasting on your wriggling petitioner? Or perhaps why have the flames from below not yet extinguished the oxygen in the air and left one or both of us gasping and flopping like stranded whales?”
My blunt reply is spoken with virtually no negative emotions, only a vague and rhetorical curiosity, and he is taken aback by it. Rather than pacify him, it only sparks a nagging fear in his brain. The image of myself suddenly leaping forward and ripping him to pieces takes form in his mind's eye, and then is gone as soon as the notion comes to him, heralded and trumpeted by the spastic firing of the semi-peripheral nerves in his gut. ‘Why am I still alive?’ His brain whimpers. Why am I still alive indeed! Simple questions have simple answers, but you've not tumbled to them yet. Letting you do so, and watching your realizations form and solidify is something of a delicacy to me. But ah, no, anguish takes his hand, gouges his eyes and leaves them bloody on the road next to its own as they blindly proceed down a wrong path entirely. Such is what happens, and such I shall watch.
"I'm dead already." He said. "Aren't I?"
Not at all, not at all, not at all. Death will skew your perspective; death will make you worthless to my observations here. You are not dead my mortal, not dead at all. And yet the cock has not crowed before the dawn my suffering martyr. Killing you now would be a single moment of pain and then an eternity of it, but there is a difference. Anguish and loss is so much sweeter, so much more poignant when it is mortal, when it sits wedded to a beating heart and a mind consumed with its own temporality. When there is still the conceivable option of something better, when there is still the rarest notion of hope in the mind of a living subject, it is a much sweeter vintage to our lips. I will not end this and drink vinegar before I must. I have no interest in taking your cup of suffering from you, I wish you to sup from it for me to drink from your lips, from the source before the source runs dry and bitter. It is so much better this way you realize. Live as long as you will.
"You are still alive." I said to him. "Your heart is beating and you still draw breath. Your mind is still full of rational thoughts and not delusions. You are very much still alive. I only have interest in you this way."
"Am I in hell?"
"From a loaded word to a loaded question." I replied. "You’re not in hell, not in the sense that you mean. But of course you mortals have done your best to bring a hell, one of them, two of them, to your doorstep with a candle burning in the window, an open door yawning, and a promise of a filling meal."
Do not quicken the arrival of your screaming descent, that would provide me with little. The end matters yes, but the interim just the same, or even more all things considered. Breath, exhale, let the ashen air kiss the layers of collagen, laminin, fibronectin, adherin... the tuning forks of gristle you play for my benefit with each word passing from your mouth. I've seen the candle burning in the window, the wax has yet the snuff the flame, and you have time still to whisper in my ear a promise of a meal in and of itself.
He paused, uncertain at my answer. So I answered him more bluntly.
"You are not in hell."
Not mine. Not yet.
"But you have done your best to unleash the hells, the lower planes, on your world. That is what I am interested in, and it does me no good to do you harm before listening and recording your story."
He looked at me with weary eyes, finally grasping the truth that he was indeed still alive, that I was not going to harm him. I simply wished to question and then to listen.
“I observe and record.” I repeated. “I do not interact, I do not influence.”
"I half expect you to be a figment of my guilt here to torment me.” He said. “For all I know, I'm dying, caught in the last moments of life and hallucinating. Why should I answer you? It only makes me remember what I've caused. Why are you interested in this, in me?"
“Again with the heavy handed questioning.” I said, gaining information even as he interrogated me. “That is what I do, this is what I am. If you do not fully understand this now, I will explain in due time, in my own way.”
He stared at me, skeptical and also fearful as well. He had thrown his last spells at me moments before. He’d pooled his remaining powers, cannibalized his mind’s arcane cache in that failed attempt to send me back whence I’d come. He had nothing left.
“Please.” I asked. “Humor me. I will not harm you. I am simply interested in learning what led to all of this. When we are done, I will step back and let you do whatever you wish to do. I will not interfere.”
The mortal finally seemed to relax, and oddly enough he actually seemed to trust me on some level. But I suspect that he was simply too tired, too filled with despair to actually bother to resist. Apathy filled him and acceptance was the result.
“We did not start this.” He stated flatly before giving a bit of a shrug. “The war itself had been going on periodically for generations before I was even born. The start of it all, that broader tempest of words and blades is lost to history, and frankly irrelevant now.”
Five hundred and thirty years to be exact, all beginning with a bit of vague and disputed language in the final will and testament of Emperor Durengal the Bold. Three years and several deaths later, his nation split into two bitterly divided kingdoms of Jurin and Tevoria, each ruled by one of his sons, their families, and their own vassal houses. In something I must of course smile over, the original disputed language was due to scribal error, not the actual terms dictated by their liege lord himself. They rage, they die, and all is pointless poetry of suffering.
“What ultimately led to this all…” He motioned around, his voice choking with displaced guilt. “They initiated it all! The Jurinites! They were the first to breach the planes and summon hellspawn.”
He means Baatezu, though he does not verbalize this response. It plays across his thoughts like the marching of ordered, organized troops conquering the territory across his visual cortex and midbrain. He hates these puppets of his enemies, unaware that his enemies were consumed in rather short order by the law-spawned fiends. No need to tell him of course, it will disrupt his recollections and sully his response. Allow him to operate under the presumption that his actions were required, if ultimately wrong, and perhaps tell him later when appropriate.
“Please continue.” I said, my words hitting his ears and hurling those marching thought patterns into disarray like his subsequent actions had attempted to do to the baatezu.
“But it was our response,” He admitted. “It was our response to their actions that brought us to this end. It was what we did that caused everything to spiral out of control. Faced with seemingly unending waves of devils, we realized that we could not kill them or banish them all. That was much too simple, and the situation didn’t allow for it. It would have been like fighting the tide from coming in by digging a trench in the sand as the waves lapped around you.”
Visions of barbazu fill his mind, all aligned in their ranks, their pikes glistening in the rising sun, faceless little ants marching in formation. He saw them. He was there with his people when they marched against them in battle that first time. Erinyes take to the air in his memories, gelugons and cornugons and even a pit fiend. My mind recognizes each and every one of them for whom the mortal’s memory paints an accurate picture. Norazhok of the Twelve Tongues, a pit fiend under the authority of Phanior, Lord of the First Command.
Norazhok…Norazhok…Indeed I know this one well. Pages turn and working in reverse I watch him melt in the fires of Phlegethos and resume a prior form of a cornugon, before which he was an amnizu, before that a spinagon, and before that a lemure formed from a larvae from the Waste sold to the Baatezu by the Hags. The irony is of course, that in life, that squealing petitioner wriggling in the dust upon our birthright flesh had been a soldier in the military of Jurin. I appreciate this most salient point, even while I hold its presumption of karmic justice in contempt.
I smiled ever so briefly the moment that he looked away into the distance.
“We realized that they had done one of two things.” He explained. “Either they had summoned and bound, or otherwise reached some contractual agreement with a noble Baatezu, maybe even one of the Nine, or they had opened a permanent portal to the Hells and managed to regulate the influx of troops in accordance with their will.”
Baatezu and a firm –lack- of control is the extreme irony in this case. They never had control, not once. And the longer I sit here listening to you, the longer I listen to -them- and filter through their memories of this as well. You are not the sole object of importance here. Rather you simply sit at the confluence of events and in a geographic locale that is convenient to my eavesdropping. You are a crumb of blood soaked cake at the edge of the first dish of many on this table, itself but the first course in a meal yet to evolve and transpire.
“After consulting one another, the other mages and I and the generals of Tevoria, it was decided that we would summon other devils. With luck, we would manage to find out the specifics of what the mages of Jurin had done.”
I nodded and let him continue.
"Much to our chagrin, none of the devils we called and bound answered us." He said. "They simply refused to speak. Eventually though, we managed to elicit one thing from them. It was a hamatula who finally broke their code of silence, and it was she who informed us -of- their code of silence, sneering and gloating with her eyes if not so much in her words. She simply said that our enemies, she did not specify beyond that, had purchased an agreement with the hells so that they would go unopposed and the devils would not be forced by conflicting contracts fight amongst themselves."
I nodded and turned a page, reading the exact words of the Hamatula in question. She is currently up for promotion, assuming she survives the holocaust working its way across the surface of this sphere.
Our silence has been purchased by virtue of binding contract between Archmage Marena of Jurin and her majesty Boremgotha the Singed of the Ministry of Mortal Relations, in association with the Court of Mephistopheles. Ancillary contracts have been drawn for the use of yugoloth mercenaries, overseen and approved by Fadreth the Golden Tongued of the Ministry of Immortal Affairs in Grenpoli, penned in duplicate by Zaereneth Ibn Portent and deposited in the archives of the first and second parties.
And this of course, the 'loth, was the obvious route to my being aware of the situation and storm clouds brewing over the home sphere of Jurin and Tevoria. But the obvious reasons are usually the least valid, especially where We are concerned, especially where I am concerned. I'd been waiting for this for a very long time, and my interest hinged on multiple levels of the conflict, like a layered sweet, a confectionary of a dozen different honeyed delights. The ‘loth simply told me that the time had arrived for this current tumbler to fall in a very complex lock, a chain and sequence of events that we’d been waiting for, watching develop according to plan.
Unaware of my contemplations though, the mortal continued his recollection, and regardless of my train of thought, his words had been and were continuing to be put to paper, put to memory, savored and their use contemplated.
"Whatever price the bastards had paid, they wished to make certain that we would be damned one way, and not the other. We could not purchase our own ransom from the fiends, not those fiends, not ever. I wish I could have known what they paid for such loyalty, because we found none at the opposite end of the spectrum."
Tanar’ri are not precisely known for their loyalty. To say nothing of the middle of the continuum…present company included.
"Did you seek out their ideological opposites, or did they come to you, offering you salvation while sniffing at the scent of your souls?" I asked, already knowing full well the answer.
"We hesitated at first, and debated for a week what our course of action would be. Some of us suggested from the outset to seek aid in the demons of the Abyss, others suggested we abase ourselves to the heavens, some abandoned us and preemptively fled, while yet others including myself thought it best to continue our attempts to communicate with the Baatorians."
He lies of course, and he knows this. He considered running along with his cowardly brethren, but he stopped at the last moment; the shame of this dashes through his mind like a man set alight within yards of a body of water. His revisionist recollection and retelling is commendable. I let him continue as he wishes. Far be it from me to prevent a lie from being told, after all, I seek the perversion of truth, not the disruption of fact. The difference is in the intent and in the point of view. Truths change, facts do not. I am here seeking his -truth- not his facts, those are already known to me a hundred times over. His words, his feelings, his remorse, his emotions, his attempted warping of fact becomes a -truth- to him, and it and how he molds it are the interesting things at hand. Descent. Spiral, spiral, spiral, pitch and turn, ever downwards little man.
"So what did you do, finding the Baatezu unwilling to budge in their prior agreements?"
"I was in the middle of an attempt to summon an Amnizu." He answered. "It was my hope that an agent of Levistus, one steeped in the draining touch of the Styx might be able to answer questions whose answer was largely absent from the minds of others. I never finished the summons though, I didn't have to, because it was preempted."
"Explain."
The scent of my children approaches now, though in this particular event their inclusion is key but minor, an undertone in this song of desolation. They have done well, little puppets, all with a -truth- of their own.
"I'd just finished the binding circle, and its translucent membrane had begun to refract and reflect the light of a dozen tallow candles in the chamber. I was alone as I did this, I'd sealed the door, and my fellows were off on their own, doing only the Hells know what."
The hells had nothing to do with this mortal, though I do detect a tinge of bitter irony inflected in your voice as you use that particular expression. Nothing but Greed was involved here. No grand manipulation, not on this level of action, this level of input, variables, and living reagents.
"I was ready to invoke the true name of the Amnizu, one Izacar the Bitter, in the direct service of Levistus. I'd hoped to avoid the ministries altogether, sidestepping the Dark Eight entirely."
The mortal began to recite the events and I settled myself, relaxed and listened while he prattled on, slipping into his mind in the process to gather the details from his perspective.
The light flickered, like a wind had blown across the wicks, and I looked up into the fading luminescence of a gate. It was subtle and quick, like a great blue and winking eye, there across the circle from me.
And I was not alone. A single figure stood just within the bounds of the circle. Luck might have smiled upon me then, but the circle was specific, far too specific to bind anything but an Amnizu, it might have even failed to hold other devils of that type except for Izacar himself.
A single figure swathed in fine robes, but what hangs in my mind still was a play of opposites that it presented before he even approached and I saw his face. A bestial snarl and the soft swish of silk against silk, the odor of brimstone and the scent of perfume, the wet sound of lips parting in a smile and then a tongue tasting the air like a serpent preparing the strike.
The figure strode into the light, moving forwards with an elegant, arrogant swagger before rapping its knuckles against the inside membrane of the binding circle’s wards, knocking upon it like an arcane door, sending ripples across its surface.
“Greetings and well met.” The fiend said, stepping into the light of the candles.
He was dressed in black robes trimmed with blue silk, a wizard with the head of a maned wolf, clawed hands clasped together at his waist. A well-dressed fiend is still a fiend though, even if he was smiling rather than screaming for blood, even if his claws were polished and engraved, and even if his long mane of ruddy-gray fur was brushed and pulled back, braided together into an elaborate knot with golden wire at his shoulders.
The mortal is confusing two separate meetings here with Y’leris, a brief, first meeting alone and a later meeting with many more wizards, and a few more ‘loths present.
“Who are you?” I demanded, standing to my feet and pointing a wand at the fiend’s chest.
“Y’leris.” He answered. “Though I suppose if you wish to have my full title, that would be Y’leris Ap Gehinnom, 34th scribe of the Abscess of the Hollow Heart. No need to be so formal though, and besides, I’m here with your best interests in mind.”
“And I could banish you in a heartbeat.” I replied, not returning his smile.
“Tsk tsk tsk…” He chided whimsically. “That would be rash I think, given the predicament you find yourselves in. And one that…”
The fiend trailed off to look down at the circle, moving one of his feet and reading the runes carved into the layer of wax that composed the outermost layer of the wards.
“And one that Izacar the Bitter probably couldn’t help you with anyways, assuming he wasn’t bound by overriding agreements to not speak with you.”
I narrowed my eyes and stared at him. He was right, and he knew it as he grinned.
“You’re in a bit of an untenable position,” He said. “But I can help you. My clients that I represent can help you greatly. Shall we talk?”
“What exactly are you?”
“I am Yugoloth, and we, my kind, are called arcanaloth.”
I knew what that implied, but I’d had no firsthand experience with his caste, so I let him explain himself.
"We are middlemen, of a sort." The arcanaloth said. "We are involved in the conflict between Tanar'ri and Baatezu, yes, but not in so straightforward a way, and not for either side in particular. Self interest, enlightened or not, is what defines us in many ways."
He paused, clasped his hands and stepped forwards into our midst, robes swishing and claws clicking staccato on the stone floor.
"We, myself, my clients, we wish to offer you our services."
"Who do you serve?"
"Interesting question that is..." He said, holding up a clawed index finger and smirking. "In general, or specifically in this case?"
"Yes."
"In general, myself, as that's all that matters really."
And from his perspective he is certainly right. That is his -truth-, that his own self-importance is the overriding factor within the hostile reality he is part of. Everything exists to be taken, used, given pain for his enjoyment simply because he wishes to do so and he can. Truth is that, and on some level it is also a fact, but only by ignorance of the larger whole of universal Evil. He is not ignorant of it though, he embraces it in many ways to give you my -truth-, a self-defining self-delusion, a liar’s lie to himself, a child of the Waste to the end. We are pieces, self-absorbed extensions of the godhead.
"And now, in this case, in specific?"
He gave a languid smile and paused for dramatic effect, overly dramatic effect.
"I am Yugoloth, but in this case I serve as agent and painted little temple whore to Hethradia, Prince of Demons. My singular/dualistic master would increase his great prestige and personal power by blunting the Baatezu here on this world.”
And give itself purpose, give itself focus, give itself clarity amidst the madness and struggle against his self, his other self, a literal house divided. A different creature entirely, but the struggle outwards placates and forestalls the struggle inwards, a similar thing to the little 'loth's focus through dissolution, importance through absence, but Demogorgon has a different Truth
"What is the price?"
"And therein lies my importance here. Let us talk and discuss your situation and salvation, shall we?"
Of course we paid too much, far too much, but as he’d said, our position was rather untenable. We were lost without some form of outside help, and that help was being offered up to us on a silver platter, dressed to our liking, if only we would sign on the proffered page of screaming, bleeding parchment.
Deeds, abstinence from the calling and binding of Baatezu for a period of decades, the banning of certain faiths, the oppression of others, the souls of half of those in our forces who fell during the coming slaughter. The terms were dictated in part, and half of them were offered up by our own people who were giving up things that meant nothing to them compared to their own survival, and their own continuance of power and prosperity.
The hope of salvation had turned us to greed, and greed had turned us to damning ourselves. I should have banished the fiend in the first place, but he would have just gone to another one of my peers, and they would have committed my sin themselves, taking his hand and welcoming him in to seduce us with words, to deliver us into the hands of his masters.
And in the end, we offered them more than they had been asking.
And of course the jackal-headed whelps looked at one another, licking their chops hungrily, and agreed
“My place in this is done.” Y’leris said. “Arsephlena the Divided will be my replacement in this matter as of three hours from this point. She speaks for the Divided Prince, and will command his forces here. Our forces, yugoloths in service to the demiurge of the Brine Flats, they will answer to an Ultroloth in the service of the Overlord of Carceri, but he will neither speak with, nor consult with you.”
I didn’t speak to the fiend as he incanted the words of his exit from our midst, but he had one last parting word to me. And I think he was more right than not.
“I suspect that we’ll be seeing one another again at some point though. Direct or indirect, savor what you’ve wrought.”
Indirect, as Y’leris has already moved on to other masters, having sold his services to Orcus within an hour of penning his deal on behalf of Demogorgon. He now serves under the nominal authority of Glyphimhor in the fortress of Tcian-Sumere, expanding his studies of necromantic lore in the depths of the Negative Energy plane, and also working to understand the lingering traces and taint of Tenebrous during that being’s occupation of the fortress. This one we will see again in due time, with his allegiances switching with the direction of the wind
And now I sit forward to listen more keenly to the mortal, as he begins to talk of the Tanar’ri, and the coming Blood War spillover
“And what happened next?” I asked him, holding up the tip of my pen to catch the light.
Pearly, opalescent in the light filtering through the smoke. There is no physical interaction though, as the ink does not exist in a material sense. It is a conception of ink, molded by thoughts and perceptions. It has the refractive index of a tear at the moment, a mortal tear mixed with a cold sweat, the proteins, exuded oils, and necrotic bacterial refuse that accompanies such. It reflects this mortal’s mood at his signatory role in the slaughter
“They came that evening on the rim of a storm from the east.” He answered. “It might have been coincidence, but more likely they had some of their kind there already to conjure the weather, or it might have been our world itself weeping for us with the rain, chiding us angrily with the crackle of thunder.
Things are bleeding together though, and events went quickly. But I remember the marilith, their general, the one the wolf-headed ‘loth had spoken of. She was hideous, a once beautiful woman with six arms and the lower body of a serpent, but something had happened to her in the past. Her serpent tail had been cut in half, split into two like a forked tongue writhing below her waist, and above that she was bald and covered in scars or acid burns.”
Nine hundred and twelve years prior on the slopes of Mungoth. It was a formative event for her
“Did they obey you at first?” I asked as I penned down the history of Arsephlena the Divided, adding this latest chapter into her career. “Did they obey the contract at all? Did they ravage your people from the start, or did they make a play at obeisance?”
“They spoke with us as little as possible actually, and when they did, their contempt was obvious. They had only nominal concern for our people, and in retrospect, it was only their generals, Arsephlena and several dozen others of her kind, along with the vrocks that eventually darkened the skies that even seemed to be implicitly aware that they had penned an agreement with us in the first place. The rest of their hordes that arrived by the hour, but they were simply cowed into submission and forced to fight, or held back from their own savage glee to slaughter the devils they could almost smell.”
“Did you not expect that? That is how the Tanar’ri operate.”
The mortal shrugged and refused to answer, a sting to his pride perhaps, a prick against his competency. In the reflected light of the flames, that bead of ink at the tip of my quill welled heavy and red.
“Describe to me the progress of the conflict. Did you go with the fiends yourself? Did you send your own people with them? Or…?”
“We didn’t trust their loyalty, nor should we have.” He replied with a scoff. “We sent our own forces into battle with them, but we held them back as observers just as much as actual combatants. We kept half of them within sight of our capital, ready to defend the city if the devils and their allies broke through, or the demons turned on us.”
“Your contingencies were wise.”
“Was that a compliment?” His asked as his face wrinkled. He wasn’t sure if it was a cruel barb, or an honest admission.
It is a question, a double-edged sword, honeyed venom. I elicit a response, even if I fail to garner an answer. I deduce what I deduce. I gather answers one way or another, you should grow wise to this soon, and the realization will give me more. The method of questioning is just as important as the questions themselves.
“Was it? Did your actions end up being wise in the light of what happened? Describe what you learned from your men at the front.” I answered him with a request.
“Our enemies were not present. It was only the Baatezu and a sprinkling of their hired yugoloths. At this stage now, I assume that they were already conquered or butchered by the devils that they had bargained with, probably some contractual loophole that they’d failed to notice.”
“I suppose that I can take some satisfaction there however.” He continued, waving a hand dismissively. “They had lost before we had lifted a finger, not that it helped us in any way of course.”
“But back to the conflict itself…” I prompted.
“Everything spiraled out of control the moment the two fiendish armies met. Things fell apart. Normal armies would have clashed and then retreated, paused to reconsider their position. They would have regrouped, resupplied, rested and made plans for the next stage of conflict.”
“But not the fiends.” I said, answering what he’d have left unsaid.
“No, they did no such thing. They slaughtered one another without pause, without rest, without retreat. They avoided us at first, but then as their numbers began to dip, they began to summon more of their kind.”
“Oh?”
“Normal summons at first, but then their more powerful members began to open gates. Those gates, they were what changed everything. We hadn’t addressed such things in any of our dealings. Those who came through the gates, they weren’t under the control of The Divided, they weren’t bound by agreement or word, they were simply there on their own, and they made no distinctions between devil or mortal or even their own kind.”
“Caught between blood-dimmed tide and reef, what did you do?”
He did not answer me, he just stared at the ground and my pen ran clear and warm, a saline fountain to match that welling in his eyes.
Shame. Abject shame. He ran. I watch it in his mind, hearing those same cries of misery, death rattles all around him, blood pumping hot in veins and in vain spilling on soil all around. He ran. He fled the scene of battle. He left his people to their own devices.
“They continued to fight. They tried to escape, to flee the field and regroup but…”
“But?...”
“I am here and there aren’t.” He replied. “That should answer your question.”
I smiled at him, and for a second time now he was taken back. It was an awkward expression, but it was as genuine as I was capable of. He’d answered my questions, but of course he wasn’t finished yet.
“You returned here.” I stated. “Had you already realized that everything had devolved beyond a point of no return? Had you come to understand what would follow?”
“Legions of devils under no command but their own, our own armies of demons now outnumbered by others of their kind who were under none of our artificial strictures… yes, I knew what would happen.”
“And it was worse by that point though, wasn’t it?”
“The mercenaries in both camps abandoned the battle when our pretensions of control evaporated.” He said bitterly. “I can see that smug smile on the face of the fiend who’d penned our agreements in the first place. I understood what he meant by savoring what I’d wrought.”
“The city was under siege already when you returned, wasn’t it?”
“Under siege? The city was burning. The fiends never needed to travel overland, they had no need to breach the walls or tear apart the gates. They simply vanished and went where they wished. By the time that we realized our control was crumbling on the battlefield, our world was already being torn apart under their hands.”
“Tanar’ri? Baatezu? Yugoloth?”
“Tanar’ri and Yugoloth.” He replied. “I suspect the Baatezu had enslaved and plundered the Jurin kingdoms already, and the yugoloths were only picking through the remains there once they had the chance like flocks of cackling vultures.”
“But they had a greater prize with your people, one largely untouched by exterior plunder.”
Plump, succulent, virginal, ripe on the vine and ready to pluck, fatted calves ready for the altar and they the high priests. But you are reserved for my cup and mine alone; the dregs are what they will claim.
“I came back to…”
He abruptly paused as I began to cough, first leaning forwards out of some woefully ill-founded concern, and then jerking back several feet out of self-preservation and fear. I was doubled over for several moments, spewing lines of yellow sputum onto the ground, with drops of blood sizzling in the ashen loam, while dots of color and distortion swam across my eyes.
But I am used to this. This is not some cross I bear, it is simply what I am and have always been. I find it amusing to read the words of those ascetics who believe that pain carried without complaint ceases to be a burden, that they purify themselves by depriving themselves of comfort. Fools. It purifies, but not in the way that they believe. Not at all. Not in the least. It fuels the fire, it fans the flames, it purifies the will and sharpens the desire. Beat me! Shame me! Drive in the nails! Flog me on my way to Golgotha to hang in perpetuity! Misery is what we are, and we are not deprived of it ourselves, not in the slightest!
"You... what is wrong with you?" He asked, his pity sickening to each and every one of my senses.
I did not answer him. I could not answer him. Not with words, spitting forth the flesh of my lungs as I was, peppering the soil, myself, and my book with that burden, that birthmark, that stigmata of our calling and our birth.
He could only watch as the convulsions grew more and more severe.
He stuttered as I shivered and salted the earth with my own vomit. The fit itself was short, only three minutes and seventeen seconds, and near the end I was crying, rigid and bracing myself against the ground. He couldn't bring himself to ask me the question burning in his head, but regardless of my ecstasy/agony, as my trembling receded and I was able to incline my face and look into his eyes, my own wide and trembling, smiling with blood and bile trailing down my chin, I gave him his answer.
“Yes. It hurts. More than you can possibly imagine...”
But you have sipped from this cup, eternally at the brim, eternally filled from within and without. You know it, you have tasted it, and here we are to taste of you. Belbau ussa zhaunil bauth dos’xukuth pholor nindol? как это чувствует? Wie fühlt es? Answer me in your pitiful way. Speak. Weep. Tell me what I want to hear. Bleed. Speak.
I was so near to him, smiling, trembling in my own chronic pain, looking into his eyes. He was frozen, speechless from fright. I did not touch him, I said nothing to him, but he looked back into my eyes. It was my expression through the pain… that it what terrified him, my embrace of what he felt in only the smallest drop.
My coughing, or rather his backwards movement in response, it stirs the air like the wings of a butterfly, the smallest, most tiny of things turning the direction of the molecules of air, then a breeze, and then the wind, shifting the currents of air and carrying the scent of a living mortal down the burning wind, down towards the west and the waiting fiends that will catch it and follow it. My little monarch, my little X, my beautiful Y, hark to the rumbling, gathering storm.
My trembling smile abrogated, and returned to a cold, curious stare. He was quiet and still, and for several minutes not a sound passed between us, only the crackle of the flames and distant screams, and other, more subtle noises that he could not yet hear. I eventually broke the silence with another question though.
“And what did you find there in your burning city? What were your intents there? Tell me.”
He is frightened still. He is now unsure that I will let him live. Answer me. Answer my questions. Answer the question. I hear them approaching now even if you cannot. Como se sente? πώς αισθάνεται? Renthisj Ar-munthrek irthir? Tell me! Answer me! I beg of you!
“I came back for my family.” He said with a tremble to his lip. “I came to find them. I came to save them. I wanted to secret them away to safety, and if I could not spare them what was coming, I would have killed them, given them a quick and painless death before taking my own life…”
“But you are still here…”
“They were ripping apart the city. Don’t you understand?! They were taking the towers and citadels themselves. One by one they’d snatched them away to other planes, or simply looted them and gutted them with flame after taking what they could.”
“And your tower? Your family? Your wife? Your children? Marena? Lucian? What of them?”
It slips his mind that I name his children.
“I saw it as they ripped it free from its foundations.” He said, pale and broken. “It hung there for a few seconds before it vanished. I don’t know where it went, what plane it was carried to. I only know that I saw the face of one of my children looking out of the uppermost window when it did. He saw me, he was looking at me, and I saw the face of the grinning fiend behind him whose fingers on his chin were showing him where to look.”
Burying his face in his hands he wept while below us in the ruins, a quarter mile distant the canoloths sniffed the wind. They turned their heads, directing their minders in our direction, up towards were we sat atop the bluff, smelling fear on the wind, smelling blood and suffering upon their tongues, lashing and tasting. Of course, I did nothing as they approached.
But you see, you do not matter in the least. You are not important. Do you think that others will cry at your passing? Your world is dead. It in and of itself is not important. I am not here simply because of you; you are only a tiny part of this, and not even the most important part, just a formative one. You are like a butterfly you see. You brushed your wings against this world and events have now passed beyond you in our little game in this cold and fickle multiverse. You have played your part and now the curtains have fallen. You have done what you were to do and now I have come calling to see, to feel, to watch, to listen, to taste, to pluck.
During our time together, sitting and chatting, there had been other fiends that had passed us by. None of them had seen us; carefully tailored circumstance had ensured that. The smoke had obscured us and masked our scent, the flames and wind had hidden our banter and our forms, but none of it had been a magical ruse on my part. I’d simply set the conditions and allowed things to proceed.
My mortal was aware that he had been safe while we had spoken, but he had assumed that it was because of action of my part. He’d though himself safe in my presence, both from any malign action on my part, and from the actions of other fiends. Vrocks, succubi, and even a Nalfeshnee had flown by overheard, and groups of rutterkin and mezzoloths had marched by without coming within a dozen yards.
Surely some revelation is at hand.
He had heard the snarl and hiss of a molydeus, the roar of a goristro, and the barking laughs of arcanaloths, and all the while he’d thought himself safe. How unfortunate for him when the first blind maw of a canoloth topped the crest of the hill and looked directly at him. It never noticed me of course as its drool pooled on the earth and its barbed tongue curled outwards, tasting and seeking.
“You seem relaxed.” I said. “You were suicidal before, but don’t you intend to protect yourself? You have no spells remaining but still, I would have expected more resistance, not willing martyrdom.”
As expected, he looked to the canoloth and then back to me in dawning horror. “But they are yours!”
“In a manner of speaking.” I replied as another four of the ‘loths topped the crown of the hill, surrounding us. “To be honest, they are more yours than mine. You brought them here. They are drawn to you.”
“But you said that you only wished to talk, to learn of what I did!” He was on his feet in an instant, stumbling and confused. “You said that you would not harm me! You said…”
“Have I harmed you?”
“No but…”
It was not yet dawn, but for the third time during our meeting, I smiled at him.
The snarling grew louder. The pack approached closer with the snapping of jaws, the wet snarl of a piscaloth, and the telepathic banter of the nycaloths giving them their orders. The mortal was trapped. There was nowhere to go.
“Thank you.” I said as I stood to my feet and stepped back, giving him more room to run, more room to struggle.
He realized his fate fully at that moment when I held my book to the side and waved at him, a pantomime of his child watching him before vanishing at the mercy of the fiends who had taken his tower and his family with it. He realized it then, just before the canoloths leapt atop him, ripping him to pieces, tearing him apart.
And of course I watched. Passionately. Apathetically. Rapt in my detachment. Why? Because I could, because I can, because we do, because I enjoy it. It is what I am. Why sit by and watch? Why take no part? Cold, distant, clinical?
It allows me to ask my question.
How does it feel?
Tell me your pain; describe to me your misery. Whet my tongue and quicken my pen across the page, a litany of what it means to be one of you. Curious. Abhorrent. We were there to watch you crawl from the muck, the slime, the dust, the primordial ooze, life from unlife, but you are guilty of our creation nonetheless. Suffer for me and I will watch, I will record, I will allow.
Suffer for me.
How does it feel?
Sarkithel fek Parthis – The Chronicler
The following was penned anonymously and delivered into the hands of the Fraternity of Order in Mechanus by a member in good standing of the Guardian sect, bearing a personal seal of Duchess Callisto of Elysium. The information is presented without comment below, though without attribution and references, even with the high level authority its accuracy has been vouched for by, the Fraternity cannot declare it affirmed as accurate:
Some have suggested that Sarkithel fek Parthis is somehow different than his fellow kindred among the Demented. Certainly the Chronicler is more subdued than many of his kin, and among those who have encountered him, while they feel horrified and sickened by his presence, they do not report him to be overtly violent. In fact, the Chronicler seems to prefer to avoid involving himself in the affairs of the planes, at least directly and overtly. Sarkithel does not poison a well or set fire to a keep, he is the one who watches the victims writhe in agony from taint or flame, doing nothing to harm them himself but taking puissant, vicarious pleasure in the propagation of the acts themselves.
Sarkithel fek Parthis is malign apathy.
He is detached cruelty.
He is distant curiosity detached from ethics.
And what are you to claim to know me? I know you. I know you well. Shall I spill your secrets as well?
The Chronicler is just as his name implies. He records the process of Evil, the progress of his kindred’s schemes, the spread of the Baerns’ moral contagion across the planes, acting as the secretary and historian of the Hegemony of Evil. He fills his role, and despite the seductive wish to label him as different from and untouched by the madness of his brother/sisters, he is likewise affected and afflicted.
Did you enjoy the look on that Asura’s face when you drowned him in the shallows of Oceanus? Did your divine patron’s desires absolve you of guilt? Or do you still worry?
There are multiple interpretations of neutral evil, just as each alignment can be manifest in different pure forms. Examples of this include the Parai and the Modrons, the Baatezu and the Kytons, and most poignantly the Rilmani and the Kamarel. In the latter case the Rilmani exist as a balance of all alignments in perfect equilibrium while their largely extinct antitheses were a rejection of them.
And there are multiple paths to universal Good, but none of you can agree on what that universal Good actually is. You are a tinder pile waiting for a spark.
It has been speculated that the Demented are an aberration among their kind, a sickness that presents itself as the norm, but in the absence of active involvement on the planes by their ancient kin, it is difficult to say that they are not correct in their claims of orthodoxy by default. The Demented exist as an embrace of the conflicting and seemingly mutually exclusive extremes of universal evil, something that they, or perhaps their now vanished fellows, sought very early on to exclude from their children the Yugoloths.
Adults withhold things from their children. Sometimes they are given to them at a later age of maturity, and sometimes they are allowed to learn and discover them on their own.
The Demented are ravaged by a sickness of being and mind, oft described as a twisted, mind-altering malady which manifests in their outlook and quixotic obsessions. Other Baernaloths are said to be simply withdrawn, apathetic, no longer filled with enough care to take an active role upon the planes, no longer possessed of the motivation to commit evil rather than simply wallow in isolation amid their own melancholic despair: oddly like the Chronicler himself.
Do not be deceived by this surface parallel.
No, the deception comes later, and frequently, often by us on ourselves. The greatest deceptions are self-inflicted.
The Chronicler may possess a veneer of Baernaloth orthodoxy, but he is every bit as active as his brethren among the 13. The hallmark of the Demented is that, in their sickness, they seek to manipulate their surroundings in meticulous, Byzantine fashion. The Chronicler, despite surface appearances perhaps to the otherwise, does this as well; he simply does so in a different and unique manner. While his brother/sisters directly insert their influence into events, or orchestrate subtle string pulling across millennia to do the same, Sarkithel is there to watch these events and processes, actively aiding and abetting his fellows in their madness by his –inaction- and his detached observations. Events occur, conditions are set, and observations are made amid the fallout.
Are you any different? You seek to manipulate others. Do you mollify your guilt by the notion that your actions are allowed, justified by the fact that you do them for the betterment of others.
Inwards however, within the cesspool of his mind, the Chronicler is just as warped as his fellows. In some instances he actively suppress his own desires to more directly steer the course of what he views as his experiments should he reach the conclusion that a given situation has not developed as expected, and there is no data of worth to be gained from continued observation. But his suppression is not uniform, and in some of these instances, he apparently has no compunctions against what amounts to sterilizing the laboratory and aborting a failed experiment. Sarkithel’s dispassion only goes so far, and inwardly he feeds upon the fallout, the active conclusion, of his inaction.
Shall I recite the death count performed in the name of Good? Or Law? Or Chaos? Balance? Am I so much more than them, because I enjoy my methods and their results?
In line with his apathy and pretensions of orthodox modality, the Chronicler is deceptively mundane in appearance and form as well. Among the Demented, he is aberrant in his lack of aberration, perverse in his normality, a lie wrapped in the cloth of the prosaic.
And what of you oh anonymous author? Does Elysium make you safe? Or does it suffocate your desires?
Fallen far from the tree of extremes represented by the Inquisitor, the Shackler, the Dire Shepherd, and above all the Ineffable, Sarkithel is disturbingly normal for his ilk, more in line with the forms of the Lie Weaver and the Blind Clockmaker. The Chronicler has the prototypical form of a Baernaloth, though perhaps one that is decidedly more spindly and frail in appearance than the norm (if there is indeed a norm), displaying no striking deviations, mutations, or flaws. Furthermore, even the sickness that he carries like a cross, or more aptly a willing stigmata, is largely understated: a form of pneumonia or pneumatic plague that is relatively quiescent except for rare periods of wet and bloody coughing.
Is there something normal for us? Does the waste engender normality in Hordelings? In the desires of Ultroloths?
In fact, the only thing of particular note about the Chronicler is that he is always observed with his book. His own particular hallmark, he has never, not once, been observed without it, though the exact size and style seems to vary, potentially according to the viewer. Some have described it as a slim artists’ or authors sketchbook or notebook, others have seen it manifest as a thick wizard’s tome, some have described it as a long codex of folded scrolls, while still others have described more fantastic sorts of ‘books’ such as tablets of wet clay, wooden scratchboards, and sheets of singed linen.
In any event however, there is always a volume in which the Chronicler takes notes, be it an actual physical book, or a variable manifestation of an appropriate cultural archetype. The Chronicler does appear to take notes in the book, meticulous and voluminous notes, but by his own admission this physical act itself is only a fraction of the material recorded across perhaps hundreds of pages each and every moment that he tasks his mind to it. He is nothing if not obsessive in his attention to detail.
And you have found little, despite your own attempts to plumb my mind. Do you worry that you spread lies in the name of truth?
But ultimately now, this leaves us with a description of the Chronicler himself, a log of his features, his motivations, an intimate record of his dispassion. To do him justice, to complete this record of him, this chronicle of him, there should rightfully be history to accompany and place this raw record into additional context.
And what good will this do? What do you feel you will accomplish?
Unfortunately here we have more speculation and suggestion than actual confirmed lore. The Chronicler is recorded in various places to have appeared at select moments leading up to, but more often during or just after great events and major turning points in history across the planes. An apocryphal githyanki text titled ‘To Know the Liberator’ claims that a being known as The Contemptuous Watcher was there on Avernus, waiting for Gith, standing at the border of Tiamat’s divine domain. The text claims that the two of them spoke at length for some time, and that afterwards Gith vanished into the Dragon Queen’s domain, never to return.
And would it be so disturbing if Gith had not been martyred, or betrayed, but had been pulled screaming into the pit. Not a messiah but a blood offering by her beloved betrayers? You are born not of triumph and self-sacrifice but of shame, cowardice, avarice... tell me...How does it feel?
The text also goes on to say that this same being appeared in Tu’narath after Ephelemon’s declaration to Vlaakith regarding the fate of Gith. The contents of their discussion are not recorded, but the text implies that Vlaakith betrayed her racial savior for power. It should be noted however that only one copy of this particular text is known to exist in full, apparently in the possession of an Alhoon and former hierophant of Maanzicorian. In light of this, the text may be more Illithid propaganda than anything else, so this particular piece of apocrypha may itself be apocryphal for our current subject.
But things are rarely so straightforward where the Gloom Fathers are concerned. Regardless of the status of the rumored full text of 'To Know the Liberator', there are stories that swirl around the imperfect copies, at least five of which are known to circulate. Those who read these flawed and incomplete versions report a distinct feeling of being watched as they do so, a cold, disturbing presence staring back at them from the pages and ink of the book itself. A githyanki warlock by the name of Caerek Grev’ir who confiscated one such copy reported that despite five separate attempts to do so, he was unable to burn the text.
And I think that you’ll find it amusing, the way in which he ultimately died. But did the flames die on him the same way that they did on that Asura?
He also reported that while he never himself opened it to learn what heretical tales it told, he was glad, relieved even when he threw the tattered collection of thin leather pages into a color pool to the Abyss. From the moment the book was in his possession, he reported a presence, something staring at him, watching him, observing him. He never once felt alone till he divested himself of the book.
How does it feel?
There are other stories as well, tales of other such books. They are books that hold some provocative twist upon accepted history, books that advance topics and notions that invoke some strong reaction in their readers. And these books are said to watch back, almost like living things, or windows for their creator to peer through, observing how the words of the books affect their readers, regardless of the truth or fiction they claim to tell. Reaction is reaction, and there is even a tale of one such book, a book of Truth, said to speak only absolute and damning fact, that was last held by an Ultroloth. The ‘loth, a prince of his kind, supposedly opened the book and beheld what abhorrent truth it spoke to him. What it said was never recorded, but he never spoke again before binding the tome in iron chains and his own flayed skin before burying it in the Waste and drowning himself in the Styx.
It seems that he didn’t appreciate my Truth, regardless of the facts. Another point in the progression of the experiment.
Personally present or not, the Chronicler seems to seed the field of his experiments and watch the conditions that result. The results are just as important as the transition that leads to whatever end occurs. He seeks 'truths' just as he seeks out facts, gorging himself upon the misery that results from the difference.
In the end what is the difference? What is your –truth-?
Sarkithel is also mentioned, this time by title, in a text purporting to detail the history of the Gautiere of Carceri’s layer of Minethys. In this instance, the Chronicler is reported as having watched the sealing of the prison-tomb of the Tiere’s divine patron, and spoken with several of the betrayed god’s former high priests after the fact. Perhaps this gives him too much credit though. Certainly the Baernaloth is not omnipresent.
I am willing to give you a list. A complete list. Come visit me and let me watch your reaction as you read. That would be my only price. My offer stands.
But when the Chronicler is not actively observing what he might determine to be key moments in the history of the planes, he is most often noted as dwelling on a semi-permanent basis on the 4th mount of Gehenna, somewhere in the ruins of an ancient city in a site known only as the Vale of Frozen Ashes. The site comprises a several mile wide swath of rubble, scarcely more than hollow shells of buildings, lines of foundations, and the broken remnants of a once massive cathedral at the city center. Otherwise the city is desolate and unoccupied, save for the Baernaloth, and save for the statues…
My eternal companions. They are always with me there. We are waiting, watching. You will see it too. We are waiting for the signs to manifest themselves.
The city is ‘populated’ by thousands of statues, tens of thousands of statues formed from compacted, frozen ashes like the entire population of the realm was in some ancient past incinerated and then flash frozen in an instant of hell. The statues, or quite possibly the remains, are primarily of fiends, mostly yugoloths, though there is also a sizable fraction of celestials of all types present as well.
Like those who were turned to pillars of salt for daring to look upon the works of a wrathful, jealous god
The statues whisper.
Would you care to know what they say? You will hear it in time. It is a warning. They have seen what will come. The clock is winding down.
The city itself is constantly awash with a subtle current of whispering wind and skittering, drifting ashes that to keen ears seem to be the weeping, terrified whispers of the dead who remain locked in petrified misery within the Vale. And it is these whispers that the Chronicler is largely obsessed with, taking note of them, recording them, and even speaking to the tormented dead around him in his madness. The content of the whispers is unknown, but they are always apprehensive if not downright terrified of something. Though it is only speculation, the Baern may use them like a bizarre oracle of sorts, or they may simply be, in their own way, slowly telling him of some ancient event that yet holds his interest.
They speak and I listen. But I already know everything of which they warn, everything they fear, because I have seen it. But foreknowledge does not make their worry any less a pleasure on my part.
The statues might also be speaking of an event that somehow has yet to occur but already has, given some bizarre statements by Sarkithel when he has been encountered by travelers in Gehenna during periods when he was lucid enough and willing to converse with them. “Waiting for the signs to manifest themselves” was his explanation for his occupation there in the city that was “rebuilding itself to happen again. Crawling towards an undesired apotheosis.”
Undesired? That all depends of course on who is speaking and who is listening. Visit me. Leave your gilded prison.
So keen to observe the city and record the dim whispers of its inhabitants, the Chronicler may never actually leave it. It seems very likely that Sarkithel is present in multiple places across the multiverse at any given moment, projecting his consciousness across the planes in some form of avatar in order to record the process of certain events that are either considered key, or simply interesting to him or his kin. Such meetings are inevitably harmful, though in comparison, face-to-face meetings with him in Gehenna are typically neutral, assuming that those seeking to converse with him are protected from the unique environment. Such meetings are not advisable however, and I would warn against them. Misery draws him, and misery flourishes in his wake.
Afraid of what I might tell you? Do come visit. You might even learn a bit about me. I’ll be waiting for you my child. Come visit and maybe you’ll finally feel alone, finally be alone. Reading from that book… come and we shall talk of what you read.
Last edited:
